Information

Is it possible to express the cistrons from a polycistronic insertion fragment in a single plasmid?


I have a insertion fragment that I wish to express from pUC19 in Escherichia coli. The insertion fragment is a sub-section from a larger operon sequence and contains just the last two cistrons from this operon.

I plan to insert this fragment into pUC19 under the control of its single lac promoter. Therefore, there will be two cistrons under the control of a single promoter (which is of course, very similar to how it would be expressed in the WT operon).

In my mind, expressing both the cistrons under the control of the single pUC19 lac promoter should allow both genes to be translated; once the mRNA is transcribed, both cistrons have their respective Ribosome Binding Sites upstream of their ORFs, and should be translated.

My question is, has anyone ever had experience expressing poly-cistronic fragments from plasmids using just a single promoter for the entire fragment? I cannot see any glaring issues with this in theory, but I thought i'd ask before I went ahead. Ultimately, I'd rather express both cistrons from a single plasmid, rather than express each cistron on a separate plasmid.

Cheers! Izaak


If I understand correctly, you are seeking option for polycistronic expression. Have you considered using T2A or P2A sequences? These come from virus and essentially break polypeptide into two parts, so-called self-cleaving peptide T2A. Real mechanism of its work is that ribosome stalls on the sequence and unable to create peptide bond, effectively re-starting translation with next after T2A amino acid.

Of course, you lose independent control over expression, both products will be expressed at same level (but degradation might be different).

So, you should consider creating construct that looks something like that:

lac:gene1-T2A-gene2-stop

Thing is that a) it might not work in E.coli and b) it might not be necessary, because primary purpose of T2A is equal expression level of two polypeptides. And, if your 2 genes are big, for bacteria it is easier to handle two separate plasmids, rather than one but much larger.


Induced Pluripotent Stem Cells Generated from Human Adipose-Derived Stem Cells Using a Non-Viral Polycistronic Plasmid in Feeder-Free Conditions

Induced pluripotent stem cells (iPSCs) can be generated from somatic cells by ectopic expression of defined transcription factors (TFs). However, the optimal cell type and the easy reprogramming approaches that minimize genetic aberrations of parent cells must be considered before generating the iPSCs. This paper reports a method to generate iPSCs from adult human adipose-derived stem cells (hADSCs) without the use of a feeder layer, by ectopic expression of the defined transcription factors OCT4, SOX2, KLF4 and C-MYC using a polycistronic plasmid. The results, based on the expression of pluripotent marker, demonstrated that the iPSCs have the characteristics similar to those of embryonic stem cells (ESCs). The iPSCs differentiated into three embryonic germ layers both in vitro by embryoid body generation and in vivo by teratoma formation after being injected into immunodeficient mice. More importantly, the plasmid DNA does not integrate into the genome of human iPSCs as revealed by Southern blotting experiments. Karyotypic analysis also demonstrated that the reprogramming of hADSCs by the defined factors did not induce chromosomal abnormalities. Therefore, this technology provides a platform for studying the biology of iPSCs without viral vectors, and can hopefully overcome immune rejection and ethical concerns, which are the two important barriers of ESC applications.

Citation: Qu X, Liu T, Song K, Li X, Ge D (2012) Induced Pluripotent Stem Cells Generated from Human Adipose-Derived Stem Cells Using a Non-Viral Polycistronic Plasmid in Feeder-Free Conditions. PLoS ONE 7(10): e48161. https://doi.org/10.1371/journal.pone.0048161

Editor: Andrea Barbuti, University of Milan, Italy

Received: April 2, 2012 Accepted: September 21, 2012 Published: October 26, 2012

Copyright: © 2012 Qu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by the National Natural Science Foundation of China (31170945) and the Fundamental Research Funds for the Central Universities of China (NO. DUT11SM04). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.


1. Introduction

Chronic infection with hepatitis B virus (HBV) is a serious global public health problem in need of improved therapies. Although an effective vaccine is available, more than 350 million people worldwide and 1.25 million people in the U.S. are chronically infected. Long term infection leads to a high risk of progression to cirrhosis and hepatocellular carcinoma and these diseases are responsible for as many as 1 million deaths each year (Lee, 1997 WHO, 2000).

Currently approved therapies for HBV are interferons, that act as immunomodulators, and nucleoside/nucleotide analogs, that act as viral polymerase inhibitors (Zoulim, 2006 Lok and McMahon, 2007). In general, these therapies suffer from a range of limitations such as incomplete efficacy, poor patient tolerance, lengthy treatment regimens, and the selection of viral escape mutants. While these problems are being addressed, in part, with the continuing development of new nucleoside polymerase inhibitors with improved efficacy and resistance profiles, it is clear that a new and different approach to HBV therapy can make an important contribution to the treatment of this disease.

RNA interference (RNAi) is a process by which gene expression can be silenced in a sequence specific manner, making it a powerful tool that is being pursued in many therapeutic applications. RNAi-based anti-viral strategies are particularly attractive since infection produces a unique set of viral transcripts that can serve as therapeutic targets. Certain aspects of HBV biology and pathology make it a good candidate for RNAi-based therapies (Lee, 1997 Romano et al., 2006). For example, the virus replicates through an RNA intermediate, so interfering RNAs can directly down-regulate viral replication and the production of infectious viral particles. In addition, the large excess of viral antigens, relative to infectious particles, produced by infected hepatocytes from either episomal or integrated forms of the viral genome, is a significant component of immune response-mediated HBV pathogenesis and persistence (Chisari and Ferrari, 1995). The ability to reduce viral antigen production by silencing viral mRNAs is an important feature of RNAi-based strategies that is not shared by nucleoside analog inhibitors of the HBV polymerase (Romano et al., 2006).

The potential value of RNAi-based approaches in treating HBV infection has been demonstrated in many studies that have used interfering RNAs to down-regulate viral transcripts in both cell culture and animal models of infection (reviewed in (Radhakrishnan et al., 2004)). Interfering RNAs that target HBV have been transfected into cultured hepatocytes either as pre-formed, synthetic, short interfering RNAs (siRNAs) (Hamasaki et al., 2003), or as plasmids that express short hairpin RNAs (shRNAs) (Shlomai and Shaul, 2003 Liu et al., 2004 Zhang et al., 2004 Moore et al., 2005 Romano et al., 2006). In a variety of mouse models of infection, HBV-targeted interfering RNAs have reduced viral antigen, transcript, or DNA production when delivered as siRNAs or as shRNAs expressed from plasmid or viral vectors (Giladi et al., 2003 McCaffrey et al., 2003 Morrissey et al., 2005 Uprichard et al., 2005 Romano et al., 2006 Ying et al., 2007). While many methods have been successful in laboratory studies, it remains a challenge to deliver RNAi agents to hepatocytes in a manner that will be clinically relevant in human patients.

In the current work we describe a new vector designed for efficient processing of multiple interfering RNAs from a single transcript that can be expressed from an RNA polymerase II promoter with the potential for tissue specific expression. The vector incorporates many features of endogenous microRNA (miRNA) gene organization that are proving useful for the development of reagents for RNAi. We expect that enhanced expression and potency of interfering RNAs in hepatocytes will augment continuing progress in the development of formulations for liver-directed delivery. Further, the expression of multiple interfering RNAs from a single transcript can provide targeting against a range of HBV serotypes and protection from the selection of viral escape mutants.


Results

Expression of the sRNA RyhB reduces the iscSUA transcript level and increases iscR transcript under iron depletion

The sRNA RyhB promotes the degradation of a group of mRNAs encoding Fe-using proteins ( Massé and Gottesman, 2002 Massé et al, 2003 , 2005 ). In an earlier experiment designed to determine new mRNAs targeted by the sRNA, we observed that RyhB downregulated the 3′-section of the iscRSUA polycistronic mRNA (shown in Figure 1A), iscSUA, while leaving the upstream iscR section intact ( Massé et al, 2005 ). We confirmed these results with quantitative real-time polymerase chain reaction (PCR), in which RyhB expression significantly decreased iscS transcript levels without affecting iscR transcript levels (data not shown). To investigate this mechanism of RyhB-induced iscRSUA polycistron discoordination, we extracted the total RNA from wild-type and ΔryhB cells grown in Luria-Bertani (LB) media in the presence of the iron chelator, 2,2′-dipyridyl (dip), which induces both RyhB and iscRSUA expressions (see the Introduction section Massé and Gottesman, 2002 ). We then carried northern blots with probes specific to iscR and RyhB transcripts. As shown in Figure 1B middle panels, the sRNA RyhB is strongly expressed in wild-type cells after the addition of dip. In the northern blots carried out with the iscR-specific probe (Figure 1B, upper panels), two distinct bands are detected. The first is a low-molecular-weight band corresponding to iscR alone and a second band of higher molecular weight corresponding to the full-length iscRSUA. Co-migration with an RNA molecular weight marker shows the length difference between the two observed bands (Supplementary Figure S1C). Although the iscR band is quite significant in the wild-type cells, it is weak in the ΔryhB cells (compare left panel with right panel in Figure 1B). Whether in wild-type or ΔryhB cells, the level of iscRSUA transcript decreases after 10–20 min, presumably because of the recovery of intracellular iron homoeostasis and activated Holo-IscR repression (see Discussion for details). When we used the same RNA samples to carry out northern blot with an iscS-specific probe, only the full-length iscRSUA fragment was detected (as shown in Supplementary Figure S1B). This indicates that both iscR and iscRSUA mRNAs exist as individual molecules in the cell.

We then investigated the steady-state expression of the iscRSUA transcript in wild-type and ΔryhB cells grown in minimal M63 media without iron, which allows constitutive RyhB expression in wild-type cells (Figure 1C, middle panel). Figure 1C upper panel shows that, although the iscR transcript is more abundant in the wild-type strain (left panel), the full-length iscRSUA transcript becomes dominant in the ΔryhB mutant (right panel). Contrary to the results obtained in the LB medium, the iscRSUA expression is very stable in ΔryhB cells grown in M63 medium without iron (compare Figure 1B and C). This suggests that IscR remains under the Apo form and does not repress the isc operon. Taken together, these results indicate that RyhB promotes the specific expression of the iscR transcript and significantly reduces the full-length iscRSUA transcript level.

The stability of the iscRSUA transcript is decreased by the sRNA RyhB

RyhB promotes the full degradation of many target mRNAs ( Massé et al, 2003 , 2005 ). However, our results with iscRSUA indicate that RyhB triggers the specific degradation of the downstream cistrons, iscS, iscU, and iscA, without affecting the iscR fragment. To investigate this, we determined the specific stability of iscRSUA and iscR mRNAs in the absence or presence of RyhB. In the experiment shown in Figure 2, we added dip in the culture for 10 min to induce ryhB and iscRSUA expression, followed by the addition of rifampicin to stop transcription. Total RNA was then extracted at different time points and the RNA was hybridised with an iscR-specific probe (Figure 2A). As shown in Figure 2B, the half-life of the iscR mRNA is almost the same whether RyhB is expressed (wild-type strain: 3.70 min) or not (ΔryhB mutant: 3.98 min). However, the half-life of the iscRSUA mRNA is significantly shorter in the wild-type strain (1.45 min) than that in the ΔryhB mutant (3.78 min). This result indicates that RyhB decreases the stability of the iscRSUA mRNA without affecting iscR mRNA.

The RNA degradosome and the RNA chaperone, Hfq, are essential for the RyhB-induced isc polarity

We showed earlier that RNase E and the RNA degradosome are involved in the RyhB-mediated degradation of target mRNAs ( Massé et al, 2003 ). We tested for the potential role of the RNA degradosome in the RyhB-induced discoordination of the iscRSUA operon during iron depletion. As shown in Figure 3B, the inactivation of the RNA degradosome (rne131 mutant) results in an increased iscRSUA mRNA level (compare with wild-type in Figure 3A). Interestingly, the iscR fragment does not accumulate significantly in the rne131 mutant. This indicates that RyhB-dependent iscR accumulation depends on partial degradation of the iscRSUA fragment and not on blocked transcription. We do not observe a notable difference between the rne131 mutant and the rne131 ΔryhB double mutant, indicating that the sRNA has no effect without the RNA degradosome.

The RNA chaperone Hfq is essential for both RyhB stability and function ( Massé and Gottesman, 2002 Massé et al, 2003 Geissmann and Touati, 2004 Morita et al, 2005 ). To investigate the role of Hfq in the iscRSUA regulation, we compare the effect of RyhB induction between wild-type and hfq cells. As shown in Figure 3C, the absence of Hfq results in reduced iscR transcript level as compared with wild type (Figure 3A). It can be noted that the level of full-length iscRSUA (at time points 15–20 min) is significantly more in rne131 and hfq cells (independently from ryhB) than in wild-type cells, showing the critical effect of these factors on the differential degradation of the iscRSUA polycistron. In addition, these results indicate that when RyhB is absent (ΔryhB) or non-functional (rne131 and hfq), the isc operon does not self-repress efficiently as in wild type. This suggests that RyhB promotes the formation of Holo-IscR by iron-sparing. Eventually, this will result in transcriptional repression of the isc operon (see the Discussion section for details).

The intergenic region between iscR and iscS forms a strong secondary structure that is responsible for the RyhB-dependant accumulation of iscR

To explain the accumulation of iscR mRNA after the expression of RyhB, we sought for potential secondary structure in the 111-nucleotide long intergenic region between iscR and iscS. Using the mfold software (http://www.bioinfo.rpi.edu/applications/mfold), we found that this intergenic region can form a strong secondary structure (Figure 4B), which is very well conserved among Enterobacteriaceae as shown in Figure 5. This conservation of secondary structure suggests an important physiological role. The secondary structure was also determined in vitro by lead acetate (PbAc) probing (Figure 4A), which cleaves single-strand RNA molecule. We note that stems P2, P3, and P4 are protected against cleavage by Pb + ions (Figure 4A and B), indicating that they are double stranded. Stems P1 and P5 are cleaved, suggesting they form weaker interactions. This structure is reminiscent of REP sequence (see the Discussion section for details).

To assess the potential role of this secondary structure, we constructed a mutant (iscmut6 see Figure 4B for description), in which we disrupted the main stem (P2). We then analysed the effect of RyhB on the iscmut6 mutant using the pBAD-ryhB vector, which expresses RyhB from an arabinose-inducible promoter ( Massé et al, 2003 ). Cells carrying either the pBAD-ryhB or control pNM12 plasmids (described in Materials and methods) were grown in minimal M63 medium, which allows the constitutive expression of the isc operon. Although the induction of RyhB (pBAD-ryhB) leads to a decrease of the full-length iscRSUA and iscmut6 transcripts, as shown in Figure 4C (left panels), accumulation of iscR fragments occurs only from the iscRSUA transcript. These results indicate that the secondary structure between iscR and iscS is necessary for the accumulation of an iscR fragment after the expression of RyhB.

We then characterised the 3′-end of the accumulating iscR RNA fragment after the expression of RyhB, by carrying out a 3′-RACE experiment (described in Materials and methods). To do this, we used the total RNA extracted from cells in which RyhB has been expressed for 30 min (see Supplementary Figure S6 pBAD-ryhB 30 min). As shown in Figure 4B, the 3′-end of the iscR fragment is situated in the untranslated region between iscR and iscS, upstream of the pairing with RyhB (see below). Hence, the iscR RNA fragment resulting from the RyhB expression contains the entire ORF of iscR and thus is likely to be translated. It can be noted that the 3′-end of the iscR fragment is situated just downstream of the stronger stem (P2) of the structure described above.

Direct pairing of RyhB at the 5′-UTR of the iscS mRNA

To investigate the effect of RyhB on the iscRSUA polycistron, we sought for a possible pairing site between both RNAs. Using bioinformatics tools, we found a putative pairing between RyhB and the 5′-UTR of iscS (Figures 4B and 6B), which covers from the region upstream of the RBS to the first codon of the target mRNA, a hallmark of negatively regulating sRNAs ( Gottesman, 2004 ). To investigate the pairing between RyhB and iscS 5′-UTR, we carried out footprinting assays with a 5′-end radiolabelled iscS RNA in the absence and presence of RyhB RNA and the RNA chaperone, Hfq. We used PbAc probing to visualise the pairing between both RNAs, as Pb + ions specifically cleave single-stranded RNA. As shown in Figure 6A, the addition of RyhB to iscS decreases the cleavage in the region of the start codon of iscS (compare lanes 8 and 9), indicating a pairing between both iscS and RyhB RNAs. The effect of the RNA chaperone, Hfq, was also addressed in this experiment. In the presence of Hfq, the protecting effect of RyhB on iscS is increased (compare lanes 9 and 11), indicating that the chaperone facilitates the pairing between both RNAs. The addition of Hfq alone protects the nucleotides between G103 and A107 (compare lanes 8 and 10), suggesting that it binds to the three Us located downstream of the iscS Shine–Dalgarno sequence. All these results are consistent with the predicted pairing shown in Figure 6B. Although it is likely that the region between G100 and U104 of iscS interacts with RyhB, there is no such evidence, as this region seems resistant to Pb + cleavage (Figure 6A).

We also tested the RyhB–iscS pairing in vivo using an iscRS′lacZ transcriptional fusion inserted in single copy at the phage-λ integration site of the chromosome (illustrated in Supplementary Figure S7 see Materials and methods for details). As shown in Supplementary Figure S3, the β-galactosidase activity is decreased in the wild-type fusion after the expression of RyhB from an arabinose-inducible promoter. We constructed several mutants of iscS to disrupt the pairing between RyhB and iscS, and we measured the β-galactosidase activity in the absence or presence of RyhB. We had to mutate at least seven nucleotides in the iscS 5′-UTR region to disrupt the RyhB effect (iscRS′mut7-lacZ). However, the RyhB mutant that is compensatory to iscRS′mut7-lacZ could not restore the wild-type effect. This suggests that, as the mutated region is close to the Hfq-binding site determined for RyhB ( Geissmann and Touati, 2004 ), the compensatory RyhB mutant becomes ineffective. Together, the in vitro and in vivo results indicate that RyhB pairs at the 5′-UTR of iscS, which is the first step to a decrease in full-length iscRSUA transcript and accumulation of an iscR transcript. The pairing is particularly strong on the iscS initiation codon region, correlating with our footprinting assays above (see Figure 6A). These results suggest that RyhB pairing could disturb translation initiation.

Physiological significance of the RyhB-induced discoordination of iscRSUA polycistron

Our 3′-RACE experiment (Figure 4B) showed that the RyhB-dependent iscR fragment contains the entire ORF of iscR. However, it is unclear whether translation remains active or not. To address this question, we used quantitative western blots to measure the levels of IscR and IscS proteins after RyhB expression. We first measured the steady-state level from wild-type and ΔryhB cells grown in minimal M63 medium (similar to Figure 1C). The results in Figure 7A indicate a significant increase (over twofold) in the IscR/IscS ratio, as cells reached an OD600 of 1.0. We also carried out a similar experiment, but with RyhB expressed from the pBAD-ryhB vector. As shown in Figure 7B, the expression of RyhB (pBAD-ryhB) leads to a significant decrease in the protein levels of IscS. However, in same conditions, IscR levels remain stable even in the presence of RyhB. These results show a fourfold increase in the IscR/IscS ratio after 4 h of RyhB expression as compared with the control experiment with an empty vector (pNM12), in which the IscR and IscS levels are not significantly affected.

IscS, IscU, and IscA are responsible for Fe–S cluster biogenesis and are thought to transfer these clusters to IscR ( Schwartz et al, 2001 ). When IscR is bound to a Fe–S cluster (Holo-IscR), it represses the isc promoter as a feedback control ( Schwartz et al, 2001 see Introduction for details). However, as the IscS level decreases after RyhB expression, we hypothesised that the IscR protein produced in these conditions is under the Apo form (without a Fe–S cluster). To test this, we measured the expression of the isc promoter using an iscR′-lacZ transcriptional fusion (illustrated in Supplementary Figure S7) inserted at the λ attachment site in a strain harbouring the endogenous iscRSUA operon. As shown in Figure 7C, the expression of RyhB from a pBAD-ryhB plasmid leads to a twofold increase in β-galactosidase activity as compared with the control plasmid (pNM12). However, if we delete the endogenous copy of the polycistron (ΔiscR), there is no significant difference in the β-galactosidase activities with or without RyhB. These results suggest that although RyhB downregulates IscS, the IscR transcriptional regulator remains expressed, however, under the Apo-IscR form.


Conclusion

Our results indicated that the 2A peptide does not produce cytotoxic effects in transgenic mice that express it in all their cells throughout development and adulthood. They also indicate that the 2A peptide functions in transgenic mice after several generations of passage through the germ-line and transgenes encoding the 2A peptide do not show attenuation in expression levels across generations. Our results also confirmed that the 2A peptide mediates co-translational 'cleavage' in a wide range of embryonic and adult tissues.

Together, this establishes the 2A peptide as a viable and, being more reliable and easier to use, a superior alternative to the IRES in mouse transgenesis. It fulfils all the functions IRES sequences are currently used for: multicistronic expression in transgenic animals and cell culture, multicistronic expression using viral vectors in entire animals, expression of exogenous coding sequences inserted by targeted recombination into endogenous loci, etc. In addition, it also provides the advantage of reliable and stoichiometric levels of expression, making it particularly useful when the relative level of expression of two or more transgenic proteins is important.

Finally, the transgenic mice reported here are useful in their own right for visualising cell membranes and nuclei in living and fixed tissue. Owing to the widespread expression of the CAG-TAG transgene, the mice are likely to be of use in a broad range of disciplines. In conjunction with time-lapse microscopy, they represent a powerful tool for following various cellular parameters such as shape, volume, movement and division rates in cultured cells, organs or entire embryos. The fortuitous insertion of the transgene in the X chromosome in one of the transgenic lines makes that line particularly useful in monitoring X chromosome inactivation.


MATERIAL AND METHODS

Strains, media and growth conditions

Molecular biology procedures and cultivations followed standard literature (Sambrook and Russell 2001). For cloning purpose, we used Escherichia coli DH5α strain (fhuA2Δ (argF-lacZ) U169 phoA glnV44 Φ80Δ (lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17) cultivated in Luria-Bertani medium supplemented with ampicillin 100 μg/mL, at 37°C. Saccharomyces cerevisiae strain CEN.PK113-5D (MATaMAL2-8 c SUC2 ura3-52 kindly provided by P. Kötter, University of Frankfurt, Germany) was used for in vivo expression and translation system. Yeast pre-inocula were maintained in YPD (1% yeast extract, 2% peptone, 2% dextrose) medium and transformants were selected on synthetic dextrose (SD 0.67% yeast nitrogen base, 2% dextrose) medium without uracil, at 30°C after lithium acetate/single-stranded DNA heat shock transformation. Experimental cultivations were conducted in the same SD-uracil medium, at 30°C for overnight.

Plasmid constructions

Plasmids were constructed based on p416 (Mumberg, Müller and Funk 1995), a centromeric plasmid carrying the green fluorescent protein (GFP) under control of TEF1 promoter CYC1 as terminator and URA3 as selection marker gene. To construct the GFP control plasmid, tCYC1 was exchanged for tADH1 using overlapping primers P13_fwd and P14_rev to amplify tADH1 fragment whereas [p416-PTEF1-GFP] (David, Nielsen and Siewers 2016) was amplified using primers P11_fwd and P12_rev with overlap to GFP and the vector as recommended by Gibson protocol (Gibson et al. 2009). Primers used in this work are listed in Table 1 and Table S1 , Supporting Information. Vector and fragments were amplified by PrimeSTAR ® HS DNA polymerase (Takara Bio Inc, Saint-Germain-en-Laye, France) according to the manufacturer recommendations. Amplicons were purified and combined in a 3:1 insert:vector ratio together to Gibson Assembly ® Master mix (New England Biolabs, Ipswich, MA, USA). Red fluorescent protein (RFP) control plasmid was constructed in the same way using primers (P11_fwd and P15_rev) to amplify vector and PTEF1. The fragment RFP-tADH1 was amplified from plasmid template p0394 with overlapping primers (P16_fwd and P14_rev).

General primers utilized in this work.

Primer identification . Primer sequence 5'–3' . Note .
P13_fwd TGGCATGGATGAACTATACAAATAGGTAGATACGTTGTTGACACTTCTAA tADH1 amplification with overlap to p416 (in bold)
P14_rev CTATAGGGCGAATTGGGTACCGGCCGAGCGACCTCATGCTATACCTGAGA
P11_fwd GGCCGGTACCCAATTCGCCCTATAG p416 amplification without tCYC1
P12_rev CTATTTGTATAGTTCATCCATGCCA
P15_rev TTTGTAATTAAAACTTAGATTAGAT Anneals to PTEF1
P16_fwd ATCTAATCTAAGTTTTAATTACAAAATGGCCTCCTCCGAGGACGTCATCA RFP amplification with overlap to p416 (in bold)
P1_fwd TGCTTTCTCAGGTATAGCATGAGGTCGCTCGGCCGGTACCCAATTCGCCCTATAG Primer forward used with reverse primers in Table S1 . Anneals to p416. Overlaps to tADH1 (in bold)
P4_rev GAGCGACCTCATGCTATACCTGAGAAAGCA Primer reverse used with forward primers in Table S1 . Anneals to the end of tADH1
Fwd_GFP_5seq GGCAGACAAACAAAAGAATGG Used for sequencing and colony PCR with P4_rev
Primer identification . Primer sequence 5'–3' . Note .
P13_fwd TGGCATGGATGAACTATACAAATAGGTAGATACGTTGTTGACACTTCTAA tADH1 amplification with overlap to p416 (in bold)
P14_rev CTATAGGGCGAATTGGGTACCGGCCGAGCGACCTCATGCTATACCTGAGA
P11_fwd GGCCGGTACCCAATTCGCCCTATAG p416 amplification without tCYC1
P12_rev CTATTTGTATAGTTCATCCATGCCA
P15_rev TTTGTAATTAAAACTTAGATTAGAT Anneals to PTEF1
P16_fwd ATCTAATCTAAGTTTTAATTACAAAATGGCCTCCTCCGAGGACGTCATCA RFP amplification with overlap to p416 (in bold)
P1_fwd TGCTTTCTCAGGTATAGCATGAGGTCGCTCGGCCGGTACCCAATTCGCCCTATAG Primer forward used with reverse primers in Table S1 . Anneals to p416. Overlaps to tADH1 (in bold)
P4_rev GAGCGACCTCATGCTATACCTGAGAAAGCA Primer reverse used with forward primers in Table S1 . Anneals to the end of tADH1
Fwd_GFP_5seq GGCAGACAAACAAAAGAATGG Used for sequencing and colony PCR with P4_rev

General primers utilized in this work.

Primer identification . Primer sequence 5'–3' . Note .
P13_fwd TGGCATGGATGAACTATACAAATAGGTAGATACGTTGTTGACACTTCTAA tADH1 amplification with overlap to p416 (in bold)
P14_rev CTATAGGGCGAATTGGGTACCGGCCGAGCGACCTCATGCTATACCTGAGA
P11_fwd GGCCGGTACCCAATTCGCCCTATAG p416 amplification without tCYC1
P12_rev CTATTTGTATAGTTCATCCATGCCA
P15_rev TTTGTAATTAAAACTTAGATTAGAT Anneals to PTEF1
P16_fwd ATCTAATCTAAGTTTTAATTACAAAATGGCCTCCTCCGAGGACGTCATCA RFP amplification with overlap to p416 (in bold)
P1_fwd TGCTTTCTCAGGTATAGCATGAGGTCGCTCGGCCGGTACCCAATTCGCCCTATAG Primer forward used with reverse primers in Table S1 . Anneals to p416. Overlaps to tADH1 (in bold)
P4_rev GAGCGACCTCATGCTATACCTGAGAAAGCA Primer reverse used with forward primers in Table S1 . Anneals to the end of tADH1
Fwd_GFP_5seq GGCAGACAAACAAAAGAATGG Used for sequencing and colony PCR with P4_rev
Primer identification . Primer sequence 5'–3' . Note .
P13_fwd TGGCATGGATGAACTATACAAATAGGTAGATACGTTGTTGACACTTCTAA tADH1 amplification with overlap to p416 (in bold)
P14_rev CTATAGGGCGAATTGGGTACCGGCCGAGCGACCTCATGCTATACCTGAGA
P11_fwd GGCCGGTACCCAATTCGCCCTATAG p416 amplification without tCYC1
P12_rev CTATTTGTATAGTTCATCCATGCCA
P15_rev TTTGTAATTAAAACTTAGATTAGAT Anneals to PTEF1
P16_fwd ATCTAATCTAAGTTTTAATTACAAAATGGCCTCCTCCGAGGACGTCATCA RFP amplification with overlap to p416 (in bold)
P1_fwd TGCTTTCTCAGGTATAGCATGAGGTCGCTCGGCCGGTACCCAATTCGCCCTATAG Primer forward used with reverse primers in Table S1 . Anneals to p416. Overlaps to tADH1 (in bold)
P4_rev GAGCGACCTCATGCTATACCTGAGAAAGCA Primer reverse used with forward primers in Table S1 . Anneals to the end of tADH1
Fwd_GFP_5seq GGCAGACAAACAAAAGAATGG Used for sequencing and colony PCR with P4_rev

All the 2A sequences were constructed between GFP and RFP by adding about 45–50 nucleotides into the reverse primer ( Table S1 , Supporting Information) for GFP-vector amplification pairing with primer forward P1_fwd (Table 1). Primers overlapping and complementing 2A sequence by 45–50 nucleotides were designed into the forward primer ( Table S1 , Supporting Information) for RFP-tADH1 amplification using reverse primer P4_rev (Table 1). Nucleotides coding the 2A sequences were codon optimized for yeast translation. After 30 min the assembly mixture was transformed into E. coli and correct assembly was verified by colony PCR using DreamTaq (Thermo Scientific) according to the manufacturer protocol using primers Fwd_GFP_5seq and P4_rev. DNA sequencing was performed with primer Fwd_GFP_5seq. Reporters were transformed into CEN.PK113-5D and selected in SD–uracil medium.

Mutation of ERBV-1 2A site

The site-directed mutagenesis was conducted using [p416-PTEF1-GFP-ERBV2A-RFP] plasmid as a template and single primer amplification method (Edelheit, Hanukoglu and Hanukoglu 2009). Primers used to promote the substitution of Pro20 to Ala were AlaF (forward): 5'-GAATTGAATCCAGGTgctATGGCC-TCCTCCGAG-3' and AlaR (reverse): 5'-CTCGGAGGAGGC-CATagcACCTGGATTCAATTC-3', where lowercase indicates the amino acid substitution. Amplifications were performed with Phusion High Fidelity DNA polymerase (2000 U/mL New England Biolabs). The single-stranded amplification products were mixed and annealed by gradually decreasing the temperature 10°C/min from 98°C to 37°C. Resulting double-strands were treated with DpnI (20 U/μL New England Biolabs) and transformed into E. coli. DNA sequencing was performed with primer Fwd_GFP_5seq to confirm the presence of the desired mutation. Mutant 2A peptide reporter was transformed into CEN.PK113-5D and selected in SD–uracil medium.

Fluorescence microscopy

Yeast strains expressing the reporters were pre-cultured overnight and then diluted to an optical density at 600 nm (OD600nm) of 0.1 in 20 mL of SD–uracil medium. Strains were cultivated at 30°C and samples were taken from mid-exponential phase (OD600nm 0.5–0.8) and washed once with phosphate buffered saline (PBS). GFP fluorescence was detected with a 525/30 filter and RFP, with 690/50 filter using a Leica AF 6000 inverted fluorescence microscope (Wetzlar, Germany) with a 100× objective. Images were processed with the Leica Application Suite software.

Western blotting

Protein extracts were prepared as described previously (Chen and Petranovic, 2015). Quantification was performed using RC DC Protein Assay (Bio Rad, Hercules, USA) against a bovine serum albumin (Sigma-Aldrich) calibration curve. A 4%–12% Bis-Tris gel (Invitrogen) was used to separate 50 μg of protein of each sample for about 2 h at 90 V in running buffer (25 mM Tris, 192 mM glycine, 0.1% SDS, pH 8.3 Bio Rad). Transfer of proteins to Polyvinylidene difluoride (PVDF) membrane (Bio Rad) was performed in a semi-dry transfer system (Bio Rad) using a transfer buffer containing 50 mM Tris, 38 mM glycine, 20% v/v methanol for 1 h at 25 V. Membranes were blocked with blocking buffer (Sigma-Aldrich) for 1 h and then incubated with the primary monoclonal antibody anti-RFP (Life Technologies, Eugene, OR, USA) or anti-GFP (Roche Life Science) for overnight at 4°C. After, membranes were washed 4 times with PBS-0.05% Tween 20, probed with secondary anti-rabbit antibody for 1 h and again washed previous to the detection by luminescence with ECL Prime reagent (GE Healthcare) and ChemiDoc XRS image analyzer (Bio Rad). The band intensities on the membranes were determined using ImageJ software. ‘Cleavage’ efficiency was calculated as follows: cleavage efficiency = 100 × (cleaved RFP form)/(cleaved RFP form + uncleaved form).

Evaluation friedelin production using the 2A system

Friedelin synthase coding sequence from Maytenus ilicifolia (MiFRS, GenBank accession number KX147270) (Souza-Moreira et al. 2016) was synthesized by GenScript with codon optimization for expression in S. cerevisiae. MiFRS sequence was subcloned into the yeast expression pSP-GM1 (Partow et al. 2010) under control of the TEF1 promoter using restriction enzymes SacI and SpeI (FastDigest, Thermo Fisher Scientific). The truncated form of HMG1 gene was cloned into the [pSP-PTEF1-MiFRS] plasmid between BamHI and SalI (FastDigest, Thermo Fisher Scientific) restriction sites under PGK1 promoter control. The plasmid [pSP-PTEF1-MiFRS, PPGK1-tHMG1] was used as control of friedelin production level in CEN.PK113-5D strain.

To demonstrate the functionality of the 2A peptide for metabolic engineering applications, the friedelin biosynthetic pathway was expressed in yeast using the bicistronic construct [pSP-PPGK1-MiFRS-2A-tHMG1]. To construct the plasmid, fragments of each module (i.e. homologous recombination module for up and down parts of the plasmid, promoter, MiFRS, tHMG1 and ADH1 terminator) were PCR amplified with overlapping primers (described in Table S2 , Supporting Information) using PrimeSTAR ® HS DNA polymerase. After gel purification, modules were PCR assembled into one fragment (Zhou et al. 2012). pSP-GM1 backbone was PCR amplified and gel-purified. Equal molar of assembled modular fragment and pSP-GM1 backbone were chemically transformed into CEN.PK113-5D. Colony PCR was used to screen the presence of assembled plasmid. Plasmids were then recovered from cell lysates, transformed into E. coli and again recovered for sequencing verification of the construct.

Quantification of heterologous friedelin production

CEN.PK113-5D transformed with empty pSP-GM1, [pSP-PTEF1-MiFRS, PPGK1-tHMG1] or [pSP-PPGK1-MiFRS-2A-tHMG1] were pre-grown in SD-uracil medium. For heterologous friedelin production, cells were diluted to a starting OD600nm of 0.05 in minimal medium (Scalcinati et al. 2012) and cultivated for 72 h at 30°C with shaking. Then, cells were collected, dried and about 30 mg of dried cell weight were extracted with chloroform:methanol (2:1, v/v Khoomrung et al. 2013) in an ultrasonic bath (2840D, Odontobrás, Ribeirão Preto, SP, Brazil) for 10 min. The organic phase was collected after addition of 0.73% NaCl and centrifugation. The extract was dried and resuspended in 200 μL acetonitrile to be analyzed by gas chromatography associated to mass spectrometry (QP2020C W/O RP230V, Shimadzu, Kioto, Japan) using a HP-5 column (30 m × 0.25 mm × 0.25 μm Agilent Technologies, Santa Clara, California, USA). Analysis was performed with inlet temperature of 270°C, heating gradient from 200°C to 290°C (10°C/min), trap temperature of 200°C, interface temperature of 290°C for 18 min, injection volume of 1 μL, split ratio of 1:10, flow gas of 1.0 mL/min, ionization of 70 eV and detection interval of 35–600 m/z. Cholesterol was spiked in as internal standard control at 40 μg/mL before friedelin extraction process. An analytical curve of friedelin standard (Sigma-Aldrich, St. Louis, Missouri, USA) was constructed. The peak of friedelin was observed at retention time of 23.08 min and identity was confirmed by mass spectral detection compared to National Institute of Standards and Technology (NIST) library and standard. Quantification analysis was done in triplicate and statistical significance was analyzed by the Student's t-test (p-value < 0.05).


Multiple widely spaced elements determine the efficiency with which a distal cistron is expressed from the polycistronic pregenomic RNA of figwort mosaic caulimovirus.

HERMAN K. EDSKES,†* JENNIFER M. KIERNAN,ANDROBERT J. SHEPHERD

Tobacco and Health Research Institute and Department of Plant Pathology, University of Kentucky, Lexington, Kentucky 40546-0091

Received 3 April 1996/Accepted 11 November 1996

The polycistronic expression mechanism of the plant pararetrovirus figwort mosaic caulimovirus (FMV)

depends upon cis-acting elements present in its pregenomic RNA and a trans-acting protein (P6) which is

expressed from a monocistronic subgenomic RNA. Using transient expression of FMV-derived polycistronic

reporter constructs in Nicotiana edwardsoniicell suspension protoplasts, we further analyzed the cis-acting

elements involved in polycistronic expression. Acis-acting element located within the first 74 nucleotides of the

7,954-nucleotide pregenomic RNA appears to be essential for P6 to transactivate expression of an internal cistron. Expression of this internal cistron, in the presence of P6, is greatly enhanced by the combined presence

of twocis-acting elements located at the 3*end of the polycistronic RNA. Surprisingly, deletion of the most

upstream of these two 3* cis-acting elements exposed a negative-acting element located internally on the

polycistronic RNA, at the 3* end of open reading frame I. The action of both this negative-acting internal

element and the positive-acting 3*elements is more pronounced when the large 5*untranslated leader region

is present. This indicates that the 5* untranslated leader region is central to regulation of the FMV gene

expression mechanism. Although a limited set of elements suffices to direct polycistronic expression in this eukaryotic system, a complex interplay between elements is involved in the spatial regulation of the genes present on the pregenomic RNA of FMV.

Caulimoviruses are a group of plant viruses with icosahedral particles which encapsidate a circular double-stranded (ds) DNA genome with a size of about 8 kb (33, 43). In the infected plant cell, this DNA genome can be found in the nucleus as a minichromosome (35). However, caulimovirus replication takes place in the cytoplasm, where a virus-encoded reverse transcriptase converts terminally redundant pregenomic cauli-movirus RNA transcripts into circular dsDNA (reviewed in reference 44). Because the caulimovirus DNA genome does not integrate into the host genome during the normal replica-tion cycle, caulimoviruses have been classified, together with animal hepadnaviruses, as pararetroviruses (45).

Like cauliflower mosaic virus (CaMV), the type member of the caulimovirus group, two major transcripts have been de-scribed for figwort mosaic virus (FMV): these are the pre-genomic and subpre-genomic RNAs (Fig. 1). The subpre-genomic RNA, which is generated from a separate promoter, is 39 colinear with the pregenomic RNA and spans only the gene VI region of the viral genome (41). The pregenomic RNA con-tains seven closely spaced open reading frames (ORFs), ar-ranged head to tail. At its 59end, it has a 570-nucleotide (nt) untranslated leader region. Under the conventional rules of eukaryotic translation initiation (30), the internal ORFs on the pregenomic RNA would not be accessible to ribosomes. More-over, in addition to it being highly structured, the 59 leader region of this transcript contains several small ORFs. These

features are believed to make the 59leader region very inhib-itory to the translation process (1, 20). It has been shown that the translational block of the pregenomic RNA leader region is released in the presence of the protein product of ORF VI (P6) (2, 19). Moreover, artificial bicistronic constructs, devoid of virtually any virus sequences, can express the downstream cistron in the presence of P6 (13). Combining these two ob-servations, Scholthof et al. (41) showed that most of the ORFs present on the pregenomic RNA of FMV can be expressed from this transcript in the presence of P6. Thus, a virus-en-coded translational transactivator (P6) appears to render the downstream cistrons on this polycistronic RNA accessible to the eukaryotic translation process.

These observations allow a basic model for caulimovirus gene expression to be formulated however, they do not explain why caulimoviruses have such a long and complex leader re-gion, nor do they give an explanation for the regulated spatial expression of caulimovirus genes. Two cis-acting elements have been described which aid in the polycistronic expression mech-anism of FMV. An element located inside ORF VII, the only ORF with no assigned function, has been shown to be essential for the ability of P6 to direct ribosomes in circumventing the translational block imposed by the leader region (20). The second cis-acting element, located in the 39region of the FMV pregenomic RNA, was revealed only upon employment of multicistronic reporter constructs that resemble the native transcript (42). This element increased the efficiency with which distal ORFs were expressed from these constructs. Thus, it seemed plausible that multiple cis-elements are involved in the expression of the polycistronic full-length transcript of caulimoviruses. Furthermore, the relative impacts of these el-ements might differ, depending on the position of a cistron within the gene array, resulting in spatial regulation of cauli-movirus gene expression.

* Corresponding author. Mailing address: Bldg. 8, Room 225, 8 Center Dr., MSC 0830, National Institutes of Health, Bethesda, MD 20892-0830. Phone: (301) 496-1309. Fax: (301) 402-0204. E-mail: Edskes @Helix.NIH.gov.

† Present address: Section on Genetics of Simple Eukaryotes, Lab-oratory of Biochemical Pharmacology, National Institute of Diabetes, Digestive and Kidney Diseases, Bethesda, MD 20892-0830.

On November 9, 2019 by guest

Http://jvi.asm.org/

Herein, we describe the identification of a set of essential and auxiliary cis-elements that control the expression of the first and third cistrons (excluding ORF VII) of FMV pre-genomic RNA. An element essential for polycistronic expres-sion has been identified within the first 74 nt of the FMV pregenomic RNA. The enhancer of polycistronic expression found at the 39end of the pregenomic RNA was further dis-sected and was shown to consist of two parts, both of which are essential for its activity. A third cis-element, acting negatively on polycistronic expression, was identified at the border of ORF I and ORF II. The action of both the 39 enhancing elements and the negative-acting element was strengthened by the presence of the 59 leader region. These findings suggest that the 59untranslated leader region, aided by cis-acting ele-ments and a translational transactivator, places caulimovirus cistrons under the control of an unique expression mechanism.

MATERIALS AND METHODS

Standard protocols.Standard molecular biology techniques were performed (38). Electroporation of Nicotiana edwardsonii cell suspension protoplasts was performed as described by Kiernan et al. (27).

CAT assays.Chloramphenicol acetyltransferase (CAT) assays were performed essentially as described by Kiernan et al. (27). In short, protoplasts were har-vested 24 h after electroporation and lysed by four cycles of freeze-thawing in

0.25 M Tris-HCl (pH 7.8). Transient expression efficiency was standardized by assaying forb-glucuronidase (GUS) expression from a coelectroporated GUS reporter construct (8) as described by Jefferson et al. (26) with a TKO 100 minifluorometer (Hoefer Scientific Instruments, San Francisco, Calif.). Proto-plast extracts were incubated for 10 min at 658C, followed by the incubation of 60-ml standardized extracts supplemented with 10ml of 2 mM acetyl coenzyme A, 1.2531023m

C]chloramphenicol (Amersham International), and 0.19 M Tris-HCl (pH 7.8) at 378C. Incubations were stopped by extracting the reaction mixture with ethyl acetate at various times, depending upon the tran-sient expression efficiency, generally after 4 h. Acetylated and nonacetylated forms of chloramphenicol were quantitated with a Packard Tri-Carb 460 liquid scintillation counter (Packard Instrument Company, Downers Grove, Ill.) as described by Gowda et al. (19). The percentage acetylation was calculated by dividing the amount of radioactivity of the acetylated forms of chloramphenicol by the total amount of radioactivity of each sample.

Plasmid constructs.The numbering of the FMV sequences described in this section is according to the nucleotide coordinates of FMV (36). However, most plasmids used in the investigation were derived from a naturally occurring mu-tant of FMV in which genes IV and V were fused because of a deletion of 1,237 nt (40). Plasmids pH66, pH66DS, pH61, pH61DS, pH61DN, pFMV-RVI, pF20CAT, pF20VIICAT, and pF32CAT have been described by Gowda et al. or Scholthof et al. (19, 20, 39, 41).

For the construction of pFMV53 and pFMV54, a SalI-StuI fragment (nt 0 to 5377) of pH66 was inserted into the SalI-SmaI sites of pNT120 (39), resulting in pFMV48. pFMV53 was created by inserting a SalI-XhoI fragment of pF20CAT, containing the FMV pregenomic promoter, into the SalI site of pFMV48. Sub-sequent deletion of the SacI fragment resulted in the nopaline synthase (NOS) terminator being placed immediately downstream of the CAT reporter gene. pFMV54 was created by insertion of a SalI fragment of pF20VIICAT, containing FMV ORF VII preceded by the FMV pregenomic promoter, into the SalI site of pFMV48, followed by deletion of its SacI fragment. pFMV52 was created by insertion of the SphI-NsiI fragment of pH66 into the SphI-PstI sites of pNT120 (39) followed by deletion of its SacI fragment. The FMV gene VI region used for the construction of pFMV58, pFMV59, and pFMV60 was derived from a clone in which an NdeI site had been created at the gene VI ATG start codon. The NdeI-BamHI fragment (nt 5361 to 7082) was cloned into pJAW141 (41). After ligation of a SacI linker (CGAGCTCG) into its StuI site, the resulting SacI fragment was cloned into the SacI site of pFMV52, pFMV53, and pFMV54, resulting in plasmids pFMV58, pFMV59, and pFMV60, respectively. Deletions in the gene VI region of pFMV58 were made with plasmid pFMV-RVI. Restric-tion sites present at the indicated posiRestric-tions were converted into SacI sites by treatment with T4 DNA polymerase or Klenow fragment followed by ligation of SacI linkers (CGAGCTCG) into the flushed sites. The resulting SacI fragments were cloned into the SacI site of pFMV52. Thus, in all cases are the gene VI segments followed by the NOS terminator. pFMV63 was derived from pFMV60 by deletion of its SalI fragment containing the FMV pregenomic promoter and gene VII. In order to create pFMV-C65, an XhoI linker (CCTCGAGG) was inserted into the EcoRI site of pGS1 (19) after it had been treated with Klenow fragment, resulting in pCaMV61. The HindIII and PstI sites of pCaMV61 were fused by treatment with T4 DNA polymerase followed by self-ligation. The resulting XhoI-SalI fragment containing the CaMV pregenomic promoter was cloned into the SalI site of pFMV63, creating pFMV-C65. Subsequent deletion of a SacI fragment created pFMV-C66. pCaMV67 was created by replacement of the SalI-SacI fragment of pFMV-C66 with a XhoI-SacI fragment containing the CAT reporter gene from pBS-CAT (32). Plasmid pFMV86 was created by deletion of an NsiI fragment (nt 3424 to 6599) from pH66. Deletion of a PstI-NsiI (nt 1560 to 6599), AflII-NsiI (nt 1029 to 6599), or ClaI-NsiI (nt 461 to 6599) fragment from pH61 resulted, respectively, in the plasmids pFMV120, pFMV121, and pFMV122. In order to create pFMV88 and pFMV89, a PstI linker (GCTGCAGC) was inserted into the EcoRI site of pNT120 (39) after it had been blunted with Klenow fragment. The NOS terminator (which was now bordered by PstI sites) was placed as a PstI fragment into the NsiI site of pH61DN. The orientation of the NOS terminator is such that it terminates transcription in pFMV88, while in pFMV89, transcription continues through the antisense NOS terminator until it reaches the native FMV terminator. In order to create pFMV91 and pFMV92, both the EcoRI (after blunting with Klenow fragment) and SmaI sites of pNT120 (39) were converted into ClaI sites by insertion of a ClaI linker (CATCGATG) . Replacement of the ClaI fragment of pH61DN with the ClaI-bordered NOS terminator resulted in pFMV91, in which the NOS terminator blocks transcription at a point about 447 nt from the start of gene I, and pFMV92, in which the antisense orientation of the NOS terminator allows transcription to proceed until the native FMV terminator is reached.

Except for the first 74 nt, the FMV leader region including

ORF VII is not needed for polycistronic expression.Six of the

seven major ORFs present on the FMV and CaMV genome have assigned functions (44). The only ORF to which no func-tion has been assigned yet is ORF VII, and a search for its FIG. 1. Genetic organization of the FMV genome. The 7,743-bp circular

dsDNA genome of FMV is indicated by a gray shaded ring. Hatched boxes in this ring represent the sub- and pregenomic RNA promoters. The positions of the major ORFs are depicted by arrows inside the ring. The two 39coterminal major RNAs transcribed from the FMV genome are indicated by peripheral arrows. The insert shows the 59leader region of the terminally redundant pregenomic RNA which contains a number of small ORFs and has the potential to form a stable secondary structure (indicated by dashed lines).

On November 9, 2019 by guest

Http://jvi.asm.org/

protein product during a CaMV infection was unsuccessful (48). However, a cis-acting element located inside gene VII aids the process by which ribosomes traverse the large and complex FMV 59leader region (20). In order to investigate if this element was needed for the FMV polycistronic expression mechanism, we constructed a series of plasmids containing a reporter, a CAT ORF fused in frame to the 39end of ORF III, that lacked either parts of the 59FMV leader region, ORF VII, or parts of the 39pregenomic RNA (Fig. 2). As controls for the transactivation process, pF20CAT, pF20VIICAT, pF32CAT, and pH66 were used (19, 20, 41). The expression of the CAT reporter from pF20CAT, a monocistronic construct in which the CAT reporter was placed immediately downstream of the FMV pregenomic RNA promoter, was not responsive to the presence of P6 (Fig. 2). However, CAT activity could only be detected when the bicistronic constructs pF20VIICAT and pF32CAT, the latter of which contains ORF VII preceded by the FMV 59leader region, were expressed in the presence of P6 (Fig. 2). When the CAT reporter ORF was moved further downstream into the FMV pregenomic RNA, CAT activity

could no longer be rescued by coexpression of P6 (Fig. 2, pFMV52). As was previously shown by Scholthof et al. (42), CAT activity could be restored in a P6-dependent manner after the 39 proximal region of the FMV pre-genomic RNA was added (Fig. 2, pFMV58). Although not as marked, a sim-ilar P6-dependent restoration of CAT activity could be ob-tained when the 59 leader region was deleted (Fig. 2, pFMV54). Addition of the FMV pregenomic 39proximal RNA segment increased CAT activity to levels comparable to those with the wild-type construct, pH66 (Fig. 2, pFMV60). Subse-quent deletion of ORF VII resulted in a similar, although less marked, pattern of CAT activity (Fig. 2, pFMV53 and pFMV59). This indicates that although the element in gene VII slightly stimulates polycistronic expression, it is not essen-tial for this response.

Although most of the leader region is deleted in plasmid pFMV53 (Fig. 2), a small 74-nt stretch of the leader is still present. This leader region was retained in the FMV pre-genomic promoter fragment because it seemed to increase the efficiency of the FMV promoter (18). To examine whether this FIG. 2. Effect of cis- and trans-acting elements in the FMV genome on expression of the pregenomic RNA. Relevant parts of plasmids used for electroporation into N. edwardsonii cell suspension protoplasts are illustrated, and indicative restriction sites and their positions are given. The CAT reporter gene is indicated by a lightly shaded box. The dotted lines represent regions which were deleted from pH66. The FMV pregenomic promoter is shown by a darkly shaded box. The transcription start site is indicated by an arrow. The rubisco terminator and the NOS terminator are indicated by RT and NT, respectively. CAT expression obtained from protoplast extracts is given as percentage acetylation and was determined by calculating the acetylated and nonacetylated forms of chloramphenicol from two independent experiments (A and B). Twenty micrograms of pFMV-RVI DNA was added to the electroporation mixture for coexpression of the transactivating gene VI protein (P6). The asterisk indicates that the electroporation mixture contained only the 10mg of pF20GUS DNA used to standardize electroporation efficiencies all of the other samples contain a total of 70mg of DNA. nd, not determined.

On November 9, 2019 by guest

Http://jvi.asm.org/

region was also involved in polycistronic expression, we re-placed the FMV promoter, including this 74-nt fragment, with the CaMV 35S promoter (Fig. 3, pFMV-C66). The CaMV promoter region included the first 27 bases of the CaMV 59 untranslated region. No AUG codon is located in this region. Surprisingly, no CAT expression could be obtained from con-struct pFMV-C66 (Fig. 3). The functionality of the CaMV promoter was verified by replacing the polycistronic CAT cas-sette in pFMV-C66 with a single CAT cistron (Fig. 3,

pCaMV67). Transcripts derived from pFMV-C66 and

pCaMV67 have comparable 59untranslated regions. Because pCaMV67 could induce the expression of a large amount of CAT activity, the inability of pFMV-C66 to direct CAT expres-sion cannot be ascribed to a defect in the CaMV promoter. Addition of the FMV pregenomic RNA 39 proximal region that stimulated polycistronic expression did not result in any enhancement of CAT activity (Fig. 3, compare pFMV-C66 with pFMV-C65). Thus, an element essential for polycistronic expression is located in the first 74 nt of the FMV leader region.

Polycistronic expression is enhanced by the combined

ac-tion of twocis-acting elements located near the 3*end of FMV

pregenomic RNA, elements which become essential in the

presence of the FMV 5*leader region.The second cistron from

a bicistronic construct becomes efficiently expressed when the caulimovirus translational transactivator is coexpressed (Fig. 2,

pF20VIICAT) (2, 19). However, a CAT ORF located inter-nally on an FMV-based polycistronic vector is only efficiently expressed when the transcripts are tailed with the FMV 39 pregenomic RNA region and P6 is coexpressed (Fig. 2, pFMV58) (42). In this study, CAT activity could be obtained from FMV-based polycistronic constructs that lacked this 39 cis-element when the FMV leader region was also deleted (Fig. 2, pFMV54). It thus appeared likely that the 59leader region functions as a negative regulator of polycistronic expression, an action that is counteracted by the 39cis-element. However, the action of this 39cis-acting element does not depend upon the presence of the 59leader region, since we found that insertion of this element into constructs pFMV54 and pFMV53 (which lack, respectively, the FMV 59 leader region and the leader region plus ORF VII) resulted in a substantial increase in polycistronic expression (Fig. 2, pFMV59 and pFMV60).

In order to better define the nature of this 39cis-element we mapped its location more precisely. Nested deletions were made from the 59 and 39 termini of the 1,706-bp fragment (spanning gene VI) in which it was contained. CAT activity directed by the resulting constructs was evaluated by electro-poration of these DNAs, accompanied by a P6 expression vector, into N. edwardsonii cell suspension protoplasts. Dele-tion of 405 bp from the 39 end, which includes the FMV transcription terminator, resulted in a marked decrease in CAT activity (Fig. 4). Upon deletion of the FMV terminator, FIG. 3. Effect of the promoter and the first 74 nt of the FMV pregenomic RNA on polycistronic gene expression. Relevant parts of constructs used for electroporation into N. edwardsonii cell suspension protoplasts are given, and the induced CAT activities are shown as described in the legend to Fig. 2. The hatched box in pFMV-C65 and pFMV-C66 indicates the CaMV 35S promoter.

On November 9, 2019 by guest

Http://jvi.asm.org/

polyadenylation signals were provided by the NOS terminator. Roughly similar values of CAT activity were observed when up to 1,075 bp was deleted from the 39end. A subsequent deletion of 401 bp abolished almost all CAT activity.

When 230 bp was deleted from the 59 end CAT activity decreased marginally, but a subsequent 401-bp deletion dra-matically reduced CAT activity (Fig. 4). This suggests that an activating cis-element is located between nt 5607 and 6008 in the FMV pregenomic RNA. This element, however, attains full activity only in the presence of a downstream element located between the 39terminus of the pregenomic RNA and nt 6678. The presence of two synergistically acting elements was verified by creating a set of constructs in which these elements were deleted or combined. Comparison between pFMV72, containing the first 59631 bp, pFMV74, containing the last 39 405 bp, and pFMV81, in which both regions are combined, clearly shows that both elements are needed for optimal enhancement of polycistronic expression (Fig. 5).

A negativecis-element for polycistronic expression is located

at the 3*end of gene I.When ORF VII is present downstream

of the FMV leader region, ribosomes are capable of reaching a subsequent CAT reporter gene with the aid of the transla-tional transactivator P6 (Fig. 2, pF32CAT). With the aid of P6, ribosomes are also capable of reaching a CAT ORF placed internally on the pregenomic RNA of FMV (Fig. 2, pFMV53 and pFMV54). However, when the FMV leader region, includ-ing ORF VII, is placed at the 59end of a polycistronic reporter cassette, almost no CAT activity is obtained unless the two 39 cis-acting elements are present at the 39 end of the reporter construct (Fig. 2, pFMV52 and pFMV58). Evidently, the ac-tions of the translational apparatus, resulting in either traver-sion of the FMV leader region, translation of a polycistronic RNA, or translation of a polycistronic RNA which is preceded by the FMV leader region, are not identical. This phenomenon was analyzed in more detail by directly comparing polycistronic FMV-based reporter constructs in which the CAT ORF was placed either directly downstream of ORF VII (pH61 based) or fused in frame with ORF III (pH66 based). As has been previously shown by Scholthof et al. (41), CAT expression from plasmids derived from both pH61 and pH66 was efficient only in the presence of P6, either derived from these plasmids or from a coelectroporated P6 expression vector. It could be

ex-pected that the expression of pH66-based constructs but not that of pH61-based constructs would depend upon the two 39 cis-acting elements. However, deletion of the gene VI region from pH61 (pH61DN) showed that CAT expression from this construct was dependent upon the 39cis-acting elements sim-ilar to that of pH66 (Fig. 6, pFMV86). This indicates that the two 39 cis-acting elements are not required for ribosomes to reach the CAT ORF once they have traversed the FMV leader region. Rather, it seems that deletion of the gene VI region reveals a negative-acting element which prevents CAT expres-sion. To map this tentative negative-acting element, a series of pH61-based deletion constructs were created. Insertion of the NOS terminator downstream of the CAT ORF in pH61 showed that the negative element is not correlated with the FMV terminator (Fig. 7, pFMV88 and pFMV89). Not until most of ORF I was deleted could CAT activity be observed again (Fig. 7, pFMV122). This places the negative-acting ele-ment between nt 461 and 1029 at the border of ORFs I and II (Fig. 7).

Viruses have developed elaborate mechanisms which allow them to efficiently express their genetic information while maintaining a minimal genome size. These mechanisms in-clude the use of multiple promoters, sequences influencing splicing efficiency, cap-independent translation, leaky scan-ning, and ribosomal frameshifting. A novel mechanism, which permits the simultaneous expression of multiple individual ORFs from one mRNA is used by caulimoviruses. It relies on the combined action of a virus-encoded translational transac-tivator protein and a set of cis-acting RNA elements. Insight into this mechanism was first obtained when it was shown that artificial bicistronic constructs could be expressed in transient expression assays when the appropriate caulimovirus signals were present (2, 19). By using a CAT ORF fused to different viral cistrons, Scholthof et al. (41) showed that the FMV pre-genomic RNA can serve as a polycistronic messenger. The novelty of this expression mechanism was enhanced by the finding that the expression of the ORFs on the polycistronic pregenomic RNA of CaMV depends on the ability of the ribosomes to engage in the translation process at the 59cap structure of the mRNA (15). This indicates that the closely spaced ORFs arranged in tandem on the pregenomic RNA are not translated by a mechanism involving internal initiation of translation. Instead, ribosomes which have initiated translation at the 59 cap structure are guided to the downstream ORFs with the aid of a virus-encoded translational activator.

The 5* leader region of pregenomic RNA.In an attempt to

better understand the regulatory elements involved in cauli-movirus gene expression, we carried out an extensive analysis of the cis-acting regulatory elements present in the pregenomic RNA of FMV. The long 59 untranslated leader region of the caulimovirus pregenomic RNA, which by computer modeling, can be folded into a large stem-loop structure (11), is very inhibitory to scanning ribosomes (1, 12). In order to allow ribosomes to traverse the FMV leader region, at least two elements are needed: a cis-acting element located inside ORF VII must be present downstream of the leader region, and the protein product of gene VI has to be simultaneously expressed in the cell (20). However, the question remained unresolved as to whether the whole 59untranslated leader region is needed for expression of the coupled ORFs on the pregenomic RNA of FMV. Deletion of most of the leader region resulted in a large increase of transactivatability of FMV-based polycis-tronic reporter constructs, indicating that this leader region is FIG. 4. Mapping of a cis-acting element in gene VI of FMV which stimulates

expression from the pregenomic RNA. Deletions were made in the FMV gene VI region of pFMV58, and the expression of the CAT reporter gene was mea-sured upon electroporation of these constructs together with pFMV-RVI DNA into N. edwardsonii cell suspension protoplasts. The restriction enzymes used to create the deletions and their positions are given.

On November 9, 2019 by guest

Http://jvi.asm.org/

not needed for polycistronic expression (Fig. 2, pFMV54). The additional deletion of ORF VII did not impede the transacti-vatability of the reporter constructs (Fig. 2, pFMV53). Thus, the cis-element present in gene VII is not essential for activation. Perhaps it acts by increasing the ability of the trans-activator to direct traversal of the leader region by ribosomes or to increase the efficiency with which a polycistronic trans-lation complex is formed at the 59end of the mRNA. Although most of the pregenomic RNA leader region was not required for the polycistronic translation mechanism, the entire leader was not dispensable. pFMV53 and pFMV54 still contain a small 74-nt 59leader region which is connected to the FMV promoter (Fig. 3). Replacement of the FMV promoter con-taining this 59leader region with the CaMV pregenomic RNA completely abolished reporter gene expression (Fig. 3, pFMV-C66). This 74-nt FMV pregenomic RNA leader region

con-tains a short ORF encoding the tripeptide Met-Arg-Gly, which is reminiscent of the short ORF shown to be needed in the 59 leader of CaMV. This short ORF is required in order to ex-press the second cistron from a bicistronic construct with the aid of the CaMV transactivator (14). It has been suggested that ribosomes which have translated a short ORF are in a poten-tially activated state in that they have not lost all the translation initiation factors when reaching the stop codon (29). In con-trast to prokaryotic ribosomes, eukaryotic ribosomes which have lost translation initiation factors upon engagement in translation are not readily able to regain them. Thus, eukary-otic ribosomes which encounter a stop codon after translating a short ORF are in a state of enhanced translational compe-tence which allows them to reinitiate translation efficiently on a downstream ORF. Indeed, when the short ORF present upstream of a bicistronic reporter system was increased to FIG. 5. Two synergistically acting cis-elements in FMV ORF VI stimulate expression from the pregenomic RNA. Relevant parts of constructs containing deletions in the gene VI region of pFMV58 are shown as described in the legend to Fig. 2. The restriction enzymes used to create the deletions and their positions are given. ORF VI ends at nt 6900. Expression of the CAT reporter gene measured after electroporation of these constructs together with pFMV-RVI DNA into N. edwardsonii cell suspension protoplasts is indicated. The levels of CAT activity obtained with construct pFMV58 without coexpression of P6 were 2% in experiment A and 1% in experiment B.

On November 9, 2019 by guest

Http://jvi.asm.org/

more than 50 nt, expression of the second reporter gene de-clined dramatically (14). However, because this second re-porter gene can only be expressed with the aid of the CaMV translational transactivator, it has been proposed that CaMV P6 stabilizes the reinitiation competence of ribosomes after translation of a short ORF. Perhaps P6 expedites translation of a polycistronic mRNA by stabilizing ribosomes which have reached a state of enhanced translational competence via translation of a short ORF. This, however, does not explain the need for the ORF VII cis-element to allow traversal of the FMV 59 leader region. For CaMV, a model was postulated which predicted that movement of the activated ribosome P6 complex through the leader region was not continuous but involved a ribosomal shunt (15). If we adapt this model for FMV, ORF VII could function in a way similar to that of short ORF F of CaMV in forming the shunt acceptor site. This may account for the slight increase in CAT activity of pFMV54, which contains ORF VII, compared with that of pFMV53, which lacks ORF VII (Fig. 2). Because the whole FMV leader region including ORF VII could be deleted without impeding the ability of a polycistronic RNA to be translated in the presence of P6, the caulimovirus pregenomic RNA leader re-gion is not essential for polycistronic gene expression but rather fulfills a regulatory function. In many retroviruses and pararetroviruses, regulatory elements involved in balancing replication and translation are found in the 59 region of the viral RNAs (37).

Elements of the 3*region of pregenomic RNA.The 39region

of the pregenomic RNA encompassing gene VI is essential for polycistronic expression of FMV-based reporter constructs (42). However, when the whole 59leader region was deleted, polycistronic expression could be obtained without this 39 cis-element (Fig. 2, pFMV53 and pFMV54). A more careful

anal-ysis revealed that there are actually two cis-acting elements located in the gene VI region of the pregenomic RNA of FMV (Fig. 4 and 5). Both elements were needed for expression of polycistronic reporter constructs in the presence of the FMV 59 leader region. In the absence of the 59 leader region, they enhanced polycistronic expression substantially (Fig. 2, pFMV59 and pFMV60). Surprisingly, at least the most up-stream of these two elements was also needed for expression of a CAT reporter ORF placed immediately downstream of ORF VII in an almost full-length FMV expression vector (Fig. 6). This was unexpected, because a reporter ORF placed in the same position but without any downstream FMV sequences was efficiently expressed with the aid of P6 (Fig. 2, pF32CAT). Thus, the need for the gene VI cis-acting sequences in an FMV-based polycistronic reporter construct arises from both the 59leader region as well as downstream elements.

Although we have not been able to support our transient expression studies with Northern analyses because of problems in obtaining enough RNA from electroporated protoplasts, the data support a model in which two elements are needed for polycistronic expression: i.e., a small ORF is needed in cis upstream of the coupled cistrons and a trans-acting factor, the ORF VI protein product, must be expressed simultaneously in the cell. The polycistronic expression process is stimulated by the combined presence of two 39cis-acting elements. However, the 39pregenomic mRNA region is also present on the sub-genomic RNA of FMV. Interestingly, the same region which increases polycistronic expression reduces the expression of the monocistronic mRNAs which contain it, an effect abro-gated by the translational transactivator P6 (42). One can spec-ulate that the 39elements act to relocate the FMV mRNAs to cytoplasmic sites with reduced translational efficiency. The same 39elements could, however, also concentrate P6 around FIG. 6. Comparison of the levels of expression of the first and third cistrons of the pregenomic RNA of FMV. Relevant parts of constructs used for electroporation into N. edwardsonii cell suspension protoplasts are illustrated, and the CAT activities they induced are given as described in the legend to Fig. 2. In pH66, the CAT ORF is fused in frame at the 39end of ORF III, while in pH61, the CAT ORF is placed between ORFs VII and I.

On November 9, 2019 by guest

Http://jvi.asm.org/

the caulimovirus mRNAs, analogous to one of the functions proposed for the poly(A) tail in attracting translation initiation factors to a mRNA (16). In this respect, it is noteworthy that P6 has been shown to have single-stranded RNA binding ac-tivity (7, 8) and that a domain of eukaryotic RNase H with similarity to P6 has dsRNA binding activity (4, 34). The inter-action between P6, produced initially in small amounts in this cytoplasmic domain, with ribosomes (7) and the caulimovirus RNAs could subsequently result in caulimovirus RNA specific translation. Interestingly the translational transactivator of peanut chlorotic streak caulimovirus (PClSV) specifically en-hances the expression of polycistronic constructs containing PClSV cis-acting signals, suggesting a direct interaction be-tween the cis-acting elements and P6 (9). Alternatively these 39 elements may interact with other factors to regulate translation much like that found in a variety of other systems, for example, translation of beta interferon mRNA (31), Cenorhabditis el-egans tra-2 mRNA (17), Trypanosoma brucei procyclin mRNA (21), satellite tobacco necrosis virus RNA (6, 46), or luteovirus RNA (47).

A negative-acting cis-element is located internally on

pre-genomic RNA. Caulimovirus mRNA regulation increased in

complexity with the identification of a negative-acting cis-ele-ment located on the border between ORF I and ORF II (Fig.

7). For full activity, this element depends on the presence of the FMV 59leader region. pFMV54 expressed CAT activity in the presence of P6, but pFMV88 did not. The action of this element was counteracted by that of the 39cis-acting elements (Fig. 7, compare pH61DS, pH61DN, and pFMV122). The func-tion of this element in the FMV life cycle is as yet open for speculation. Like all retro- and pararetroviruses, caulimovi-ruses have a complex replication cycle that includes both nu-clear and cytoplasmic phases. Pararetroviruses transcribe their genome into a pregenomic RNA in the nucleus, after which it is transported to the cytoplasm, where it is reverse transcribed into a DNA genome. This mode of replication depends upon the ability of a large pregenomic RNA molecule to escape the nuclear splicing process, a process that in eukaryotes is known to be tightly linked to nuclear export, with unspliced transcripts being degraded rather than exported (10, 25). In both retrovi-ruses and hepatitis B virus, RNA signals have been described that aid the virus in this process (3, 5, 23, 24). It thus is not unlikely that caulimoviruses contain similar signals. That cauli-movirus RNAs interact with the nuclear splicing machinery is illustrated by the fact that deletion mutants have been found in which the deleted sequences are bordered by consensus mRNA splice sites (22, 40). An interaction between the pre-genomic RNA of CaMV and the nuclear splicing apparatus FIG. 7. Identification of an element on the pregenomic RNA of FMV which downregulates the expression of gene I. Relevant parts of constructs used for electroporation into N. edwardsonii cell suspension protoplasts are shown, and the CAT activity they induced is given as described in the legend to Fig. 2. The NOS terminator is indicated by NT. When NT is present in a nonfunctional, reverse orientation, it is indicated by being placed upside down.

On November 9, 2019 by guest

Http://jvi.asm.org/

was recently substantiated by Kiss-La´szlo´ et al. (28). Because FMV requires P6 for the expression of each of the ORFs present on its pregenomic RNA, it has been speculated that P6 not only functions in translational transactivation but also aids nuclear cytoplasmic transport (39). It seems likely that a dy-namic interplay exists between regulatory RNA sequences and P6, each participating individually or in combination with each other in several steps of the caulimovirus life cycle.

We are indebted to Indu Maiti for the gift of pBS-CAT. We thank Katja Richert-Poeggeler, Neil Weitzmann, and Huei-Fung Tsai for critical reading of the manuscript. Arcady Mushegian is gratefully acknowledged for his sage advice.

H.K.E. was a recipient of a Philip Morris Fellowship. This research was supported in part by NIH grant KTBR 5-41043/86.

1. Baughman, G., and S. H. Howell. 1988. Cauliflower mosaic virus 35S RNA leader region inhibits translation of downstream genes. Virology 167:125– 135.

2. Bonneville, J. M., H. Sanfac¸on, J. Fu¨tterer, and T. Hohn.1989. Posttran-scriptional trans-activation in cauliflower mosaic virus. Cell 59:1135–1143. 3. Brighty, D. W., and M. Rosenberg. 1994. A cis-acting repressive sequence

that overlaps the Rev-responsive element of human immunodeficiency virus type 1 regulates nuclear retention of env mRNAs independently of known splice signals. Proc. Natl. Acad. Sci. USA 91:8314–8318.

4. Cerritelli, S. M., and R. J. Crouch. 1995. The non-RNase H domain of Saccharomyces cerevisiae RNase H1 binds double-stranded RNA: magne-sium modulates the switch between double-stranded RNA binding and RNase H activity. RNA 1:246–259.

5. Cullen, B. R., and M. H. Malim. 1991. The HIV-1 Rev protein: prototype of a novel class of eukaryotic post-transcriptional regulators. Trends Biochem. Sci. 16:346–350.

6. Danthinne, X., J. Seurinck, F. Meulewaeter, M. Van Montagu, and M. Cornelissen.1993. The 39untranslated region of satellite tobacco necrosis virus RNA stimulates translation in vitro. Mol. Cell. Biol. 13:3340–3349. 7. De Tapia, M., A. Himmelbach, and T. Hohn. 1993. Molecular dissection of

the cauliflower mosaic virus translational transactivator. EMBO J. 12:3305– 3314.

8. Edskes, H. K. 1994. Ph.D. thesis. University of Kentucky, Lexington. 9. Edskes, H. K., J. M. Kiernan, and R. J. Shepherd. 1996. Efficient translation

of distal cistrons of a polycistronic mRNA of a plant pararetrovirus requires a compatible interaction between the mRNA 39end and the proteinaceous trans-activators. Virology 224:564–567.

10. Elliott, D. J., F. Stutz, A. Lescure, and M. Rosbash. 1994. mRNA nuclear export. Curr. Opin. Genet. Dev. 4:305–309.

11. Fu¨tterer, J., K. Gordon, J. M. Bonneville, H. Sanfac¸on, B. Pisan, J. Pen-swick, and T. Hohn.1988. The leading sequence of caulimovirus large RNA can be folded into a large stem-loop structure. Nucleic Acids Res. 16:8377– 8390.

12. Fu¨tterer, J., K. Gordon, H. Sanfac¸on, J.-M. Bonneville, and T. Hohn.1990. Positive and negative control of translation by the leader sequence of cau-liflower mosaic virus pregenomic 35S RNA. EMBO J. 9:1697–1707. 13. Fu¨tterer, J., and T. Hohn.1991. Translation of a polycistronic mRNA in the

presence of the cauliflower mosaic virus transactivator protein. EMBO J. 10:3887–3896.

14. Fu¨tterer, J., and T. Hohn.1992. Role of an upstream open reading frame in the translation of polycistronic mRNAs in plant cells. Nucleic Acids Res. 20:3851–3857.

15. Fu¨tterer, J., Z. Kiss-La´szlo´, and T. Hohn.1993. Nonlinear ribosome migra-tion on cauliflower mosaic virus 35S RNA. Cell 73:789–802.

16. Gallie, D. R., and R. Tanguay. 1994. Poly(A) binds to initiation factors and increases cap-dependent translation in vitro. J. Biol. Chem. 269:17166–17173. 17. Goodwin, E. B., P. G. Okkema, T. C. Evans, and J. Kimble. 1993. Transla-tional regulation of tra-2 by its 39untranslated region controls sexual identity in C. elegans. Cell 75:329–339.

18. Gowda, S. 1991. Personal communication.

19. Gowda, S., F. C. Wu, H. B. Scholthof, and R. J. Shepherd. 1989. Gene VI of figwort mosaic virus (caulimovirus group) functions in posttranscriptional expression of genes on the full-length RNA transcript. Proc. Natl. Acad. Sci. USA 86:9203–9207.

20. Gowda, S., H. B. Scholthof, F. C. Wu, and R. J. Shepherd. 1991. Require-ment of gene VII in cis for the expression of downstream genes on the major transcript of figwort mosaic virus. Virology 185:867–871.

21. Hehl, A., E. Vassella, R. Braun, and I. Roditi. 1994. A conserved stem-loop structure in the 39untranslated region of procyclin mRNAs regulates ex-pression in Trypanosoma brucei. Proc. Natl. Acad. Sci. USA 91:370–374. 22. Hirochika, H., H. Takatsuji, A. Ubasawa, and J.-E. Ikeda. 1985. Site-specific

deletion in cauliflower mosaic virus DNA: possible involvement of RNA splicing and reverse transcription. EMBO J. 5:2759–2762.

23. Huang, J., and T. J. Liang. 1993. A novel hepatitis B virus (HBV) genetic element with Rev response element-like properties that is essential for ex-pression of HBV gene products. Mol. Cell. Biol. 13:7476–7486.

24. Huang, Z.-M., and T. S. B. Yen. 1995. Role of hepatitis B virus posttran-scriptional regulatory element in export of intronless transcripts. Mol. Cell. Biol. 15:3864–3869.

25. Izaurralde, E., and I. W. Mattaj. 1992. Transport of RNA between nucleus and cytoplasm. Semin. Cell Biol. 3:279–288.

26. Jefferson, R. A., T. A. Kavanagh, and M. W. Bevan. 1987. GUS fusion:

b-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6:3901–3907.

27. Kiernan, J. M., F. C. Wu, K.-B. Goldberg, S. Gowda, and R. J. Shepherd. 1993. Transformation in Nicotiana edwardsonii, p. 294–307. In Y. P. S. Bajaj (ed.), Plant protoplasts and genetic engineering III. Springer-Verlag, Berlin, Germany.

28. Kiss-La´szlo´, Z., S. Blanc, and T. Hohn.1995. Splicing of cauliflower mosaic virus 35S RNA is essential for viral infectivity. EMBO J. 14:3552–3562. 29. Kozak, M. 1987. Effects of intercistronic length on the efficiency of

reinitia-tion by eucaryotic ribosomes. Mol. Cell. Biol. 7:3438–3445.

30. Kozak, M. 1992. Regulation of translation in eukaryotic systems. Annu. Rev. Cell Biol. 8:197–225.

31. Kruys, V., M. Wathelet, P. Poupart, R. Contreras, W. Fiers, J. Content, and G. Huez.1987. The 39untranslated region of the human interferon-bmRNA has an inhibitory effect on translation. Proc. Natl. Acad. Sci. USA 84:6030– 6034.

32. Maiti, I. B. Unpublished data.

33. Meagher, R. B., R. J. Shepherd, and H. W. Boyer. 1977. The structure of cauliflower mosaic virus. I. A restriction endonuclease map of cauliflower mosaic virus DNA. Virology 80:362–375.

34. Mushegian, A. R., H. K. Edskes, and E. V. Koonin. 1994. Eukaryotic RNAse H shares a conserved domain with caulimovirus proteins that facilitate trans-lation of polycistronic RNA. Nucleic Acids Res. 22:4163–4166.

35. Olszewski, N., G. Hagen, and T. J. Guilfoyle. 1982. A transcriptionally active, covalently closed minichromosome of cauliflower mosaic virus DNA isolated from infected turnip leaves. Cell 29:395–402.

36. Richins, R. D., H. B. Scholthof, and R. J. Shepherd. 1987. Sequence of figwort mosaic virus DNA (caulimovirus group). Nucleic Acids Res. 15: 8451–8466.

37. Rothnie, H. M., Y. Chapdelaine, and T. Hohn. 1994. Pararetroviruses and retroviruses: a comparative review of viral structure and gene expression strategies. Adv. Virus Res. 44:1–67.

38. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

39. Scholthof, H. B. 1990. Ph.D. thesis. University of Kentucky, Lexington. 40. Scholthof, H. B., F. C. Wu, R. D. Richins, and R. J. Shepherd. 1991. A

naturally occurring deletion mutant of figwort mosaic virus (caulimovirus) is generated by RNA splicing. Virology 184:290–298.

41. Scholthof, H. B., S. Gowda, F. C. Wu, and R. J. Shepherd. 1992. The full-length transcript of a caulimovirus is a polycistronic mRNA whose genes are trans activated by the product of gene VI. J. Virol. 66:3131–3139. 42. Scholthof, H. B., F. C. Wu, S. Gowda, and R. J. Shepherd. 1992. Regulation

of caulimovirus gene expression and the involvement of cis-acting elements on both viral transcripts. Virology 190:403–412.

43. Shepherd, R. J., R. J. Wakeman, and R. R. Romanko. 1968. DNA in cauli-flower mosaic virus. Virology 36:150–152.

44. Shepherd, R. J. 1989. Biochemistry of DNA plant viruses, p. 563–616. In A. Marcus (ed.), The biochemistry of plants. Academic Press, Inc., New York, N.Y.

45. Temin, H. M. 1985. Reverse transcription in the eukaryotic genome: retro-viruses, pararetroretro-viruses, retrotransposons, and retrotranscripts. Mol. Biol. Evol. 2:455–468.

46. Timmer, R. T., L. A. Benkowski, D. Schodin, S. R. Lax, A. M. Metz, J. M. Ravel, and K. S. Browning.1993. The 59 and 39 untranslated regions of satellite tobacco necrosis virus RNA affect translational efficiency and de-pendence on a 59cap structure. J. Biol. Chem. 268:9504–9510.

47. Wang, S., and W. A. Miller. 1995. A sequence located 4.5 to 5 kilobases from the 59end of the barley yellow dwarf virus (PAV) genome strongly stimulates translation of uncapped mRNA. J. Biol. Chem. 270:13446–13452. 48. Wurch, T., D. Kirchherr, J.-M. Mesnard, and G. Lebeurier. 1990. The

cauliflower mosaic virus open reading frame VII product can be expressed in Saccharomyces cerevisiae but is not detected in infected plants. J. Virol.


Genetics Exam 4

Vectors are bacterial plasmids- they're modified for cloning. The basic features of all of them is that they can replicate (origin of replication), antibiotic resistant genes (so you can introduce this without DNA cells recognizing it) and it must have places around the plasmid where restriction enzymes only cut once, and only once. You want it to be open up so it can accept an insert, and the plasmids have been modified where the sites only cut once.

2. Cut DNA with Restriction Enzymes

3. Insert DNA fragments into a "Vector" (plasmid)

4. Introduce recombinant DNA into host cell E. coli)

5. Each bacterial colony contains a single recombinant DNA clone
*restriction enzyme used for whole genomes is YAC

RNA and DNA together now, and RNA H degrades RNA and it only degrates RNA that is attached to DNA. You add this in to take away the RNA but not all, then add DNA poly 1 and it will fill in the spaces and will use the primer to chug along and cut out RNA and replace it with DNA.
Add DNA ligase & seal, now you have a DNA piece that coresponds with a messanger. To get into a plasmid, you must manipulate more steps (don't need to know)

Just know reverse transcriptase & enzyme Rnase H

short sequences (2-50 bases long)
multiple copies at many different sites
individuals vary in the number of copies
2-100 copies per site at

-Half of the increase has been due to improvements in agricultural practices, half to plant breeding

-Herbicide resistance - grow plants without chemicals is not realistic to support our whole population - spraying with organically synthesized compounds is always a risk, this particular compound is the least toxic we know of but not completely nontoxic, this kills all plants by blocking EPSP which blocks amino acid synthesis (all animals get amino acids from diet) glyphosate has low toxicity to all animals and it degrades quickly in soil
-FDA put this on the carcinogen list SO it has the potential to cause cancer but it is not known to cause cancer, only people at risk are people who make or use this compound

The process of producing a DNA copy from an RNA molecule is termed reverse transcription. It is carried out by one of the enzymes carried in the virus, called reverse transcriptase. After this DNA copy is produced and is free in the nucleus of the host cell, it must be incorporated into the genome of the host cell. That is, it must be inserted into the large DNA molecules in the cell (the chromosomes). This process is done by another enzyme carried in the virus called integrase (see figure 2).

Now that the genetic material of the virus is incorporated and has become part of the genetic material of the host cell, we can say that the host cell is now modified to contain a new gene. If this host cell divides later, its descendants will all contain the new genes. Sometimes the genes of the retrovirus do not express their information immediately.

Retroviral vectors are created by removal op the retroviral gag, pol, and env genes. These are replaced by the therapeutic gene. In order to produce vector particles a packaging cell is essential. Packaging cell lines provide all the viral proteins required for capsid production and the virion maturation of the vector. These packaging cell lines have been made so that they contain the gag, pol and env genes. Early packaging cell lines contained replication competent retroviral genomes and a single recombination event between this genome and the retroviral DNA vector could result in the production of a wild type virus. Following insertion of the desired gene into in the retroviral DNA vector, and maintainance of the proper packaging cell line, it is now a simple matter to prepare retroviral vectors (see figure 3).


Materials and Methods

Ethics Statement

Intratracheal administration of viral vectors was performed under 2,2,2 Tribromoethanol anaesthesia and all efforts were made to minimize suffering. All mouse experiments were carried out in strict accordance with the recommendations in the Canadian Council on Animal Care (CCAC) “Guide to the Care and Use of Experimental Animals” and under the conditions and procedures approved by the Animal Care Committee of McGill University (AUP number: 5819).

Generation of Plasmid Vectors

Entry plasmids.

All plasmid vectors were produced using standard cloning techniques. A more exhaustive description of the protocols used, construction history and plasmid sequence are available on request. All plasmids described herein will be made available through Addgene (www.addgene.org). AttL1-attL2 flanked genes were cloned into either pENTR-D TOPO plasmids from PCR products or into pENTR1 using standard restriction enzyme based methods. DNA containing attR2-attL3 or attR3-attL4 sites separated by a multi-cloning region was synthesized by BioBasic and used to produce two pOK1/2-derived [22], kanamycin resistant entry plasmids, pBEG R2-L3 and pBEG R3-L4. The multi-cloning region separating the attX-sites contained the sequence GGGCCGGCGCGGCCGCACGCGTGCTGAGGAGACATCTAGACTTTCCCTCAGCGTCGACGATATCGGCGCGCCCCCGGG . pBEG R2-i*X-R3 containing the ‘strong’ (IRES* [23]) was produced by cloning the IRES cassette from pQXIN IRES* (a gift from Daniel Gray UCSF) into the RE3-RE4 sites of pBEG R2-L3. pBEG R2-IRESX-R3, which contains the ‘weak’ IRES, was cloned from a pQCXiX-derivative containing a puromycin resistance marker (N-acetyl-transferase gene) to create pBEG R2-iPuro-L3. Drug resistance genes conferring neomycin, blasticidin-S (blasticidin-S deaminase) and hygromycin-B (hygromycin phosphotransferase) were excised from pQCxix-derived plasmids and cloned between BglII/EcoRV sites of pBEG R2-iPuro-L3.

A miRNA-30 cassette was synthesized by BioBasic and cloned into the NotI/EcoRV sites of pBEG R3-L4 to create pBEG R3-miRNA(X)-L4. Next an EcoRI/XhoI flanked chloramphenicol-ccdB cassette was cloned into the EcoRI/XhoI sites of the miRNA-30 cassette creating pBEG R3-miRNA(ccdB)-L4, which greatly simplifies the cloning of novel EcoRI/XhoI flanked shRNAs.

Viral destination plasmids.

Synthesis of a single fragment containing tandem attR1–attR4 sites was repeatedly unsuccessful. Thus, we synthesized individual attR1 and attR4 sites, and cloned them into pOK1/2 such that they were separated by a chloramphenicol resistance marker to produce pBEG R1-ChlorR-R4. The chloramphenicol selection cassette was PCR amplified from a lab Gateway destination vector (gQxiPuro, unpublished plasmid) using the following forward ( 5′-CACC TCTAGA CTCGAGATTAGGCACCCCAGGCTTTACAC ) and reverse ( 5′-ATATGAATTCGTCGACCTGCAGACTGGCTGTG ) primers and cloned into the XbaI site of pOK1/2 B [22] giving pOK1/2 B (ChlorR). Next, the attR1 site from pUC57 fragment A was cloned into this vector using BglII/NotI giving pBEG R1-ChlorR-R4.

To create the three way destination vector (attR1-attR3) the attR4 site was replaced with attR3 from pBEG R3-L4 which was cut out with NheI/NgoMIV and cloned into the SpeI/XmaI site of pBEG R1-ChlorR-R4 creating pBEG R1-ChlorR-R3. Finally, the ccdB-ChloroR cassette from gQxiPuro was cloned into both the pBEG R1-ChloroR-R3 and pBEG R1-ChloroR-R4 vectors with NotI/SalI. Once both R1–R4 and R1–R3 Gateway cassettes existed as pBEG plasmids it was possible to produce the destination vectors pLEG and pREG. To this end, the R1–R3/R4 cassettes were excised with BglII/HpaI and cloned into pLEXiPuro (Open Biosystems) at BamHI/HpaI sites and with SacII/HpaI into gQxiPuro at SacII/EcoRV sites. Thus, the following four destination vectors were produced: two lentiviral vectors pLEG(R1–R3) and pLEG(R1–R4) and two retroviral vectors pREG(R1–R3) and pREG(R1–R4).

All viral destination vectors produced by this system use a self-inactivating (SIN) 3′ LTR that harbours a deletion in the U3 region, rendering the LTR transcriptionally inactive. This deletion is copied to the 5′ LTR during reverse transcription preventing further viral replication and greatly reducing the likelihood that viral insertion will activate endogenous oncogenes [24], [25].

Luciferase reporter plasmid.

A separate destination dual luciferase reporter plasmid, pCheck2 Dest (R1–R2), was created by blunt end cloning of an attR1–attR2 destination cassette (Invitrogen) into the NotI site (blunted using Klenow) of pSiP1 [26].

miRNA-shRNA design Plasmids. All miRNA was produced by PCR using a ∼100 bp oligonucleotide “shRNA template” and amplified with universal primers. The 5′ universal primer ( 5′-CACCCTCGAGAAGGTATAT TGCTGTTGACAGTGAG ) and 3′ universal primer ( 5′-CCCCTTGAATTC CGAGGCAGTAGGCA ) were based on those used by Hannon et al. [11]. PCRs were performed using 0.5 units Phusion polymerase, 200 nM dNTP, 400 nM of each primer, 400 nM template, 704 nM DMSO with 30 cycles (10 sec 98°C, 30 sec 60°C, 60 sec 72°C).

PCR-amplified shRNA fragments were cloned between XhoI and EcoRI sites (italicized in universal primers) of the miRNA cassette. The shRNA template oligonucleotide must have a corresponding overlap with the universal primers (underlined and in green) as shown: shRNA core template = TGCTGTTGACAGTGAG CGA(shRNA Sequence)C TGCCTACTGCCTCG (bolded nucleotides can vary but cannot complement one another, see [11], [27]). shRNA structures are based on published sequences [28] all having a constant 19-bp loop sequence ( X -TAGTGAAGCCACAGATGTA- X’ ) flanked by 19–23 nt sequences ( X and X’ ) homologous to target (double underlined).

Mouse p53 specific shRNAs:

HP65: TGCTGTTGACAGTGAG CGCCCACTACAAGTACATGTGTAATAGTGAAGCCACAGATGTATTACACATGTACTTGTAGTGGA TGCCTACTGCCTCGGA

HP44: TGCTGTTGACAGTGAG CGCGGAAATTTGTATCCCGAGTATTAGTGAAGCCACAGATGTAATACTCGGGATACAAATTTCCT TGCCTACTGCCTCGGA

HP18: TGCTGTTGACAGTGAG CGACCAGTCTACTTCCCGCCATAATAGTGAAGCCACAGATGTATTATGGCGGGAAGTAGACTGGC TGCCTACTGCCTCGGA

GFP or dsRed specific shRNAs:

GFP01: TGCTGTTGACAGTGAG CGAGCACAAGCTGGAGTACAACTATAGTGAAGCCACAGATGTATAGTTGTACTCCAGCTTGTGCC TGCCTACTGCCTCGGA

dsRed01: TGCTGTTGACAGTGAG CGCAACGAGGACTACACCATCGTTAGTGAAGCCACAGATGTAACGATGGTGTAGTCCTCGTTG TGCCTACTGCCTCGGA

shLuc: TGCTGTTGACAGTGAG CGCCCGCCTGAAGTCTCTGATTAATAGTGAAGCCACAGATGTATTAATCAGAGACTTCAGGCGGT TGCCTACTGCCTCGGA

LR recombination reactions.

Two-plasmid recombination reactions were performed using LR Clonase II in a 5 µL reaction (10 fmol Entry plasmid, 20 fmol Destination plasmid, 1 µL LR Clonase II Invitrogen cat# 11791-020). Three and four plasmid recombination reactions used LR Clonase II Plus were performed in a total 5 µL (0.5 µL each of 10 fmol/µL Plasmid A (attL1–L2), Plasmid B (attR2-L3), Plasmid C (attR3-L4), 0.5 µL of 20 fmol/µL Destination Plasmid, 0.5 µL of LR Clonase II Plus cat# 12538-120). LR Clonase II reactions were incubated for 1 hour and LR Clonase II Plus reactions were incubated for 16–24 hours prior to proteinase K treatment and transformation into chemically competent DH10B bacteria.

Tissue Cell Culture and Transfections

Cell culture.

HEK 293T and NIH 3T3 were cultured in DMEM (Wisent) containing +10% v/v FBS, 1% penicillin/streptomycin (Wisent) and 1% v/v 1 M HEPES solution at 37°C with 5% CO2. Cells were trypsinized and split 1∶10 into fresh plates at regular intervals to prevent them from reaching confluence. Mouse embryonic fibroblasts were isolated as described [29] and were cultured in DMEM containing 10% FCS, 1% penn/strep. All MEFs were cultured for a maximum of 4 passages.

Transfections.

HEK 293T cells (5×10 6 per 100 mm dish) were transfected using a Polyethyleneimine (P.E.I.) solution at a 2.65∶1 ratio (P.E.I. mass:DNA mass) [30]. 42 µL of P.E.I. (1 mg/mL) was added to 16 µg of plasmid DNA diluted in 600 µL OMEM and incubated 30 minutes before addition to cells in DMEM supplemented with 10% FBS. Cells were incubated at 37°C overnight for 293T cells or 6 hours for NIH 3T3 cells and then the media was replaced. For luciferase assays, 5×10 4 HEK 293T cells were seeded in each well of a 24 well dish before transfection with PEI and 0.74 µg (total) plasmid DNA per well.

Virus Production and Infections

Lentivirus was produced by co-transfection of pAX2 (5.2 µg), pMDG (2.8 µg) and the recombinant viral plasmid (6 µg) (14 µg DNA total, PEI and OMEM ratio as described previously) into HEK 293T cells seeded at 60% confluence in 100 mm dishes. To produce retrovirus, LNXE producer lines were transfected with 16 µg of pREG plasmid. In both cases media was removed after 48 hours, filtered through a 45 µm filter and added to the recipient cells undiluted.

Immunoblots

Stable transduced NIH 3T3 cells were left untreated or were incubated with 0.2 µg/mL doxorubicin for 6 hours. Total protein was extracted from 1×10 6 cells lysed at 95°C in 1X Laemmli buffer. Protein was separated by 10% SDS PAGE and immunoblotted using standard methods with primary anti-p53 antibody (1∶1000 dilution, Cell Signaling cat# 2524) or anti-tubulin (1∶8000, Sigma cat# T5168) antibody and a HRP-conjugated secondary antibody (1∶2500 GE Healthcare Life Sciences cat# NA931VS).

Luciferase Assays

HEK 293T or NIH 3T3 cells were seeded (5×10 4 cells per well) in a 24 well dish and were incubated overnight. DNA mixes contained either a 4∶1, 2∶1 or 1∶1 molar ratio of lentiviral plasmid expressing miRNA to luciferase reporter (always using 100 ng of reporter plasmid) were made up to 0.74 µg of total plasmid DNA by adding a third recombinant lentiviral plasmid lacking the miRNA cassette. Transfections were performed using P.E.I. as described previously. Cells were washed with 1X PBS 48 hours post-transfection and then lysed in 100 µL Passive Lysis Buffer (Promega cat# E1941) per manufacturers instructions. Firefly and Renilla luciferase contents were quantified using a Tecan 200 plate reader/injector combination running i-Control software using 5 µL of HEK 293T and 20 µL NIH 3T3 lysates to maintain signal linearity. Luciferase assay solutions were from Promega (Dual-Luciferase Reporter Assay System cat# E1910) or made as described [31], [32]. 100 µL of firefly luciferase assay solution was injected per well, shaken for 2 seconds and the luminescence measurement integrated over 10 seconds, followed in the same manner by injection of100 µL of Renilla luciferase assay solution.

Cell Imaging

Fluorescence cell imaging was acquired using a Leica DM IL LED inverted microscope with X-cite series 120 Q UV source, QICAM Fast 1394 camera attachment (Q IMAGING) and filter sets from CHROMA: CFP: ET436/20x, ET480/40 m, T455lp, GFP: ET470/40x, ET525/50 m, T495LPXR, dsRed: ET545/30x, ET620/60 m, T570lp.

Infection and Analysis of Mouse Lungs

Lentivirus made from recombinant plasmids expressing eGFP, Cre and Luciferase was produced and concentrated by centrifugation as described in [33]. Concentrated virus was titred by infecting 1×10 5 HEK 293T cells per well of a 6 well dish with lentiviral dilutions made in 1X PBS at either a 1∶10 or 1∶100 dilution. To each well, 10 µL or 100 µL was added in the presence of 4 µg/mL of polybrene. The proportion of eGFP-positive cells was determined by standard flow cytometry analysis 72 hours post-infection.

Equivalent infectious units of virus (1–2×10 8 IU) were introduced into the lungs of Braf CA/+ mice through direct intratracheal administration (as described in [33]) after pre-treatment with sodium caprate, which enhances infection efficiency [34]. Mice were euthanized at 8 and 16 weeks after infection and the lungs were processed for histology and Ki67 as described [35]. Slides were stained with hematoxylin and eosin (H&E) and for Ki67 before being scanned using an Aperio Scanscope AT. Individual slides were analyzed using Aperio ImageScope software, in which each tumour was circumscribed to obtain the section area (µm 2 ) and the percentage of Ki67-positive cells was obtained using the IHC Nuclear Algorithm.


DISCUSSION

Genes encoding anguibactin biosynthesis and utilization functions lie within several operons which are located on a 25-kb region of the V. anguillarum virulence plasmid (48). However, to achieve maximal expression of this iron-scavenging system, products from a noncontiguous region of the plasmid are required. This region, designated TAF, encodes trans-acting factors which act to increase production of the siderophore anguibactin (48) as well as to enhance the expression of a polycistronic mRNA encoded by ferric anguibactin transport and biosynthesis genes (37).

In this work, we have begun the dissection of the TAF region and have determined that there are at least two components. One, TAFb, is directly associated with anguibactin biosynthesis, while the other, TAFr, plays a regulatory role in the expression of the polycistronic mRNA encoded by fatDCBAangRT. The fact that AngR is not only a regulatory protein itself but also a biosynthetic enzyme, as is AngT (52), suggests that TAFr plays an indirect role in anguibactin biosynthesis via its regulatory effect on the two biosynthesis genes present in the same polycistronic mRNA. Our results support this hypothesis: strains lacking the TAFr region were not fully complemented by TAFb for the expression of the fatDCBAangRT operon or for anguibactin production. However, TAFb clones do fully complement both for expression of the fatDCBAangRT operon and for anguibactin production when the strain harbors TAFr.

In this report, we have focused on the analysis of the TAFb component. Our analysis demonstrated that the TAFb region encodes several ORFs exhibiting high levels of homology to proteins involved in the biosynthesis and utilization of DHBA-containing siderophores, such as vibriobactin (55) and enterobactin (31, 41). Only two ORFs, B and F, were found to have the potential to encode functional proteins. However, we showed by generation of an internal deletion that ORF F is not necessary for anguibactin biosynthesis. Our mutagenesis and complementation experiments also demonstrated that two genes within ORF B, now designated angB and angG, are the only genes within this cluster which are necessary for anguibactin biosynthesis. The TAFb region containing this cluster is flanked by identical and inverted insertion sequence elements, forming a composite transposon-like structure. Similar insertion sequences flank the fatDCBAangRT operon (17, 43). These observations suggest that the V. anguillarum virulence plasmid may have acquired siderophore biosynthesis and utilization genes horizontally via transposition events. Chance and necessity may have prompted the acquisition of a mobile unit carrying angB and angG along with the other genes, even though angB and angG were the only two genes in this cluster needed for anguibactin production. These nonessential genes in the TAFb cluster may have accumulated mutations and become pseudogenes later in the evolution of this system. It is also of interest that the gene organization of the pseudogenes ORF C and ORF E, as well as the angB gene, in the TAFb cluster is identical to that of the chromosomally encoded vibC, vibE, and vibB genes of V. cholerae (55), and this organization is distinct from that of the same genes in E. coli (31, 41). It is tempting to speculate that the TAFb cluster originated in V. cholerae or in an ancestral organism and that it was acquired by the V. anguillarum virulence plasmid through transposition events and horizontal transfer.

Members of Earhardt's laboratory isolated transposon mutations in the 3′ end of the entB gene that resulted in truncated EntB proteins with the phenotype EntB + Ent − , suggesting that an EntG activity was encoded in the 3′ end of the entB gene. Immunological and in vitro transcription-translation analysis identified only a protein with a molecular mass corresponding to that of EntB (41). Therefore, the experimental evidence gathered using the approaches described above strongly suggested that EntB is a bifunctional protein. However, these investigators pointed out that their studies did not completely eliminate the possibility that a separate EntG polypeptide exists (41).

Our genetic analysis of the TAFb component angB demonstrated that it is a single ORF encoding two distinct functions that are essential for anguibactin biosynthesis. Either of these two activities, B or G, can function independently of the other: a stop mutation at the BglII site located at 194 bp from the translational start of angB, or a deletion of these first 194 bp, destroys B activity without affecting the G activity. Furthermore, deletions of 345 bp from the 3′ end abolish G activity, while B activity is unaffected. The B activity encoded by the angB gene corresponds to a 37-kDa protein. The truncated version generated by the 3′-end deletion, which still possesses B activity, was also identified in V. anguillarum as a protein whose molecular mass corresponds to 172 amino acids. We believe that the B activity is an isochorismate lyase (24, 35) required for the conversion of isochorismate to 2,3-dihydro-2,3-DHBA, not only due to the fact that AngB and EntB exhibit significant homology, but also because deletion mutations in the 5′ end of the gene that results in the loss of B activity are rescued by the addition of DHBA. Conversely, strains carrying just the 5′ end of angB, possessing B activity but deficient in G activity, secrete DHBA.

Our present genetic evidence indicates that, at least in angB mutant backgrounds, an independent entity with G activity can exist in V. anguillarum, since a strain with a nonpolar mutation in the 5′ end of the angB gene exhibits G activity even when this mutation is introduced onto the virulence plasmid by allelic exchange. This activity correlates with the presence of three polypeptides that are encoded in the 3′ end of the angB gene and are all translated in the same frame as AngB, as demonstrated by using an E. coli overexpression system and protein microsequencing. Although the genetic evidence for the existence of a separate AngG polypeptide is very strong, we were unable to detect such a protein in any V. anguillarum strain, potentially due to low levels of this protein. Because of this we were unable to determine the biological significance of this protein. Our present efforts are directed at elucidating whether AngB and/or one or all of the smaller polypeptides encode the G activity in wild-type cells by creating silent mutations in the ribosome binding sites for the angG-encoded polypeptides.

Recently, Gehring et al. (24) demonstrated that in the bifunctional EntB protein the enterobactin assembly activity resides in the C-terminal portion (residues 188 to 285) and showed that EntB must have a C-terminal apo-aryl carrier protein domain that undergoes covalent phosphopantetheinylation, most probably at serine 245, located in a consensus sequence. Comparison of the carboxy-terminal end of AngB with the AngG polypeptides and the carboxy-terminal end of EntB identified a similar domain (FLGLDSI) with a serine residue located at position 248. In AngB this domain extends from amino acids 243 to 249, and it is also present in the corresponding portions of the AngG proteins. Our results demonstrated that an S248L mutation results in the loss of the G activity while conserving the B activity, indicating that this serine residue is essential for G activity. However, we could not determine whether the loss of G activity caused by the mutation in AngB is due to an effect on the AngG polypeptides only or also in the corresponding sequence in the carboxy-terminal end of AngB. What is clear is that the same mutation in the nonpolar mutant B − G + ::K, which should only synthesize the AngG polypeptides, results in the loss of G activity. Since this mutation was a single nucleotide change resulting in the S248L mutation, it is likely that the change is occurring only at the protein level, thus providing further proof of the existence of the AngG polypeptides in these strains. The results of in vivo phosphorylation experiments suggest that the carboxy-terminal end of AngB functions as an aryl carrier protein involved in the assembly of the anguibactin molecule. Since the S248L mutation abolishes G activity in a strain that should synthesize only the AngG polypeptides, it is reasonable to think that the S248 site in AngG is also modified and that AngG is an aryl carrier protein, although these modified polypeptides were not detected in V. anguillarum.

Our present efforts are directed to elucidate whether one or all of the smaller polypeptides encode the G activity. We have also identified open reading frames within the TAFr region which might encode the functions responsible for the TAFr activity. Analyses of these will contribute to the understanding of the molecular nature of the TAFr regulatory activity encoded by the V. anguillarum virulence plasmid.