Information

B13. Summary - Biology


1. When it moves through a:

  • nongated channel, it establishes the resting potential
  • a voltage gated channel, it repolarizes the cell after an action potential
  • channel that is gated by chemical modification (such as phosphorylation), it may hyperpolarize the membrane (make it more negative inside) and facilitate neuron inhibition

2. If two ions are involved in signaling, the result depends on

  • if the two species move simultaneously through the same channel (which results in excitation through an initial depolarization of membrane if the ions are potassium and sodium)
  • if the two species move through different channels in a sequential fashion (which generates an action potential) if the ions are potassium and sodium).

In summary, ligand and voltage gated channels allow changes in the polarization of the membrane. Other mechanisms can also lead to changes. Membrane proteins can be phosphorylated (using ATP) by protein kinases in the cell, leading to a change in the conformation of the membrane protein, and either an opening or closing of the channel. Channels linked to the cytoskeleton of the cells can also be opened or closed through stretching. Other stimuli that gate channels are light (through photoisomerization-induced conformational changes), heat, and cold.

Contributors

  • Prof. Henry Jakubowski (College of St. Benedict/St. John's University)

Smart Edu Hub

The parent plant produces hundreds of reproductive units called spores in its spore case. When this spore case of the plant bursts, the spores are released and they travel in air and land on food or soil. Here they germinate and produce new plants.

ADVANTAGES OF ASEXUAL REPRODUCTION to a species in the wild and crop production:

  • Favourable characteristics of parents are passed on.
  • Dense colonies outcompete other species.
  • Less energy/resources are used.
  • Only one parent is needed.
  • If parent is well adapted then the offspring will be well adapted to the environment

DISADVANTAGES OF ASEXUAL REPRODUCTION to a species in the wild and crop production:

  • There is competition for resources.
  • There is little or no variation
  • Less evolution[or] Less ability to adapt to the change.
  • It is possible that all may get killed by a single disease.

BOARD EXAM QUESTION:
Describe the process of reproduction in bacteria: 3 marks

16.2: SEXUAL REPRODUCTION :

  • SEXUAL REPRODUCTION:It is a process involving the fusion of the two nuclei of two gametes (sex cells) to form a zygote and the production of offspring are genetically different from each other.
  • FERTILISATION:It is the fusion of gamete nuclei.
  • The nuclei of the gamete are haploid
  • The nuclei of the zygote are diploid.

ADVANTAGES OF SEXUAL REPRODUCTION TO AN ANIMAL SPECIES:

  • The population of the species can be increased.
  • It allows variation within the species which is caused by independent assortment.
  • Recessive traits can also get expressed.
  • The organism can adapt better to changing environment.
  • It allows the evolution of species.
  • There is seed dispersal
  • There is colonization

DISADVANTAGES OF SEXUAL REPRODUCTION TO AN ANIMAL SPECIES:

DISADVANTAGES OF SEXUAL REPRODUCTION TO A PLANT SPECIES

  • Needs two parents [or] Needs a pollinating agent.
  • Much pollen is wasted [ or many seeds are wasted]
  • Fertilisation may not happen
  • There is a loss of a lot of energy

16.3: SEXUAL REPRODUCTION IN PLANTS:

PARTS OF AN INSECT POLLINATED FLOWER:

FOLLOWING ARE THE FUNCTIONS OF THE:

  • Sepals: It protects the flower when in the bud condition
  • Petals: In insect-pollinated flowers, its function is to attract insects .
  • Anthers: To produce sex cells
  • Stigmas It is the top of the female part of the flower and it&rsquos function is to collects pollen grains
  • Ovaries: It&rsquos function is to produce the female sex cells

COMPARING THE FEATURES OF INSECT POLLINATED AND WIND POLLINATED FLOWERS:

  • The flowers are dull green or brown or not colourful
  • There are small petals [ or] There are lack of petals
  • Flowers are small or inconspicuous
  • Bracts are presence
  • Filaments are long
  • Anthers/Stigmas hang out of the flowers
  • Anthers are loosely attached
  • Stigmas hang out of the flowers
  • Stigmas are feathery
  • Stigmas have a large surface area
  • Larger amount of pollen are produced.
  • There is no nectary
  • Flowers do not have scent

FEATURES OF POLLENS OF WIND POLLINATED FLOWERS:

  • Pollen is light
  • Pollen is nit sticky/is smooth
  • Pollen has a large surface area
  • Large amounts of pollen are produced
  • Pollen is small

SELF AND CROSS POLLINATION:

SEXUAL REPRODUCTION IN HUMANS:

1. Labeled diagram of the male reproductive system

2-PARTS AND FUNCTIONS OF THE MALE REPRODUCTIVE SYSTEM:

  • PENIS-To insert semen into vagina
  • URETHRA-To pass semen through penis
  • TESTIS-To make sperm(testosterone)
  • VAS DEFERENS(Sperm duct)-To pass sperm from testis to urethra
  • SROTUM-To keep the testis at a temperature lower than that of the body
  • PROSTRATE GLAND-To produce seminal fluid
  • EPIPIDYMUS-To mature an store the sperm

3. LABELLED DIAGRAM OF THE FEMALE REPRODUCTIVE SYSTEM

4.STRUCTURE AND FUNCTIONS OF THE FEMALE REPRODUCTIVE SYSTEM

  • OVARIES-To produce the hormones oestrogen and progesterone/ It is also the site of egg development and ovulation
  • FALLOPIAN TUBES-(Oviducts)-Carry the ovum from the ovary to the uterus
  • UTERUS-Place for embryo and fetus developement
  • CERVIX-Involved in menstruation/ It holds the fetus in place during pregnancy/ Dialates during birth to allow the fetus to leave the uterus.
  • VAGINA-Provides a passageway for the sperm and menstrual flow/ It also functions as the birth canal

5 ROLE OF PLACENTA IN MAINTAINING PREGNANCY:

  • It secretes progesterone to keep the lining of the uterus thick to maintain pregnancy in-order to prevent the breakdown of the uterus lininG

6. ROLE OF PLACENTA IN THE DEVELOPMENT OF THE FETUS: board question-4m

  1. Exchange of materials e.g. oxygen/glucose/ water/amino acids/antibodies/urea/carbon dioxide
  2. Acts as a physical attachment between fetus and uterus/mother t
  3. Prevents the mixing of mother and fetal blood
  4. Protects against mother&rsquos (high) blood pressure
  5. Plays protective role in preventing the entry of some pathogens A
  6. It secrets progesterone to keep lining of uterus thick/prevents menstruation/to prevent breakdown of uterus lining or it prevents uterine muscle contracting

7 FUNCTIONS OF THE PLACENTA

  • It acts as a barrier between the blood systems and thus prevents the mixing of the maternal and the fetal blood
  • It supplies oxygen to the fetus
  • It supports the fetus
  • It protects against sudden movements and bumps
  • It helps to lose carbondioxide and urea from the fetus
  • It helps to transfer antibodies from the mother
  • It helps to supply and remove water

8. EXCHANGE OF MATERIALS ACCROSS THE PLACENTA

THE FOLLOWING SUBSTANCES PASS FROM THE MOTHER TO THE FETUS:

  • Oxygen
  • Glucose
  • Amino acids
  • Lipids/fattu acids and glycerol
  • Vitamins
  • Ions ( Na, Ca, Fe_
  • Alcohol, nicotine and other drugs
  • Viruses
  • Antibodies

THE FOLLOWING SUBSTANCES PASS FROM THE FETUS TO THE MOTHER:

8. FUNCTIONS OF AMNIOTIC FLUID AND AMINIOTIC SAC: BOARD QUESTION-[2 MARKS]

AMNIOTIC FLUID::

  1. Protects fetus from physical damage/cushions
  2. It acts as shock absorber AW REJECTED ANSWER:prevents shock /PROVIDES SUPPORT
  3. Prevents unequal pressures from acting on fetus/
  4. maintains constant environment/allows free movement
  5. Protects fetus from temperature fluctuations REJECTED insulates
  6. Protects fetus from drying out

AMNIOTIC SAC:

  1. Scretes/produces amniotic fluid
  2. Encloses/contains THE amniotic fluid

COMPLETE SET OF THE ABOVE pdfs at our membership website: Link

9.CHILD-BIRTH

10.BIRTH CONTROL METHODS-Board-Question-12MARKS

  • Natural:
  1. It the rhythm method or the calendar method.It is important to know the pattern of the mentstrual cycle. There should be no intercourse when egg is in the oviduct.One indicator of ovulation is the rise in the body temperature
  2. The next natural method is to withdraw the penis from the vagina before ejaculation to prevent sperm comming in contact with the egg
  3. The last natural method is abstinence from sex to avoid pregnancy
  • Chemical:
  1. Contraceptive pills that contain progesterone and oestrogen prevent ovulation
  2. Morning-after-pill: this pill prevents the fertilised egg from implanting in the uterus
  3. Spermicidal cream applied to vagina kills the sperms
  • Mechanical:
  1. Using a condom prevents sperm comming in contact with the eggs
  2. Use of IUD prevents the fertilised eggs from implanting in the uterus
  • Surgical:

Vasectomy/Laparotamy: In vasectomy oviducts are cut and sealed and in laparotamy the sperm ducts are cut so that no eggs an dsperm can pass through


Answers for all kerboodle work AQA GCSE

I don't know if you mean the questions from the textbooks on Kerboodle, but here's the link for all the AQA Gcse science textbooks end of spread answers. They also have the answers for the small end of page questions.

(Original post by amygracem.x)
I don't know if you mean the questions from the textbooks on Kerboodle, but hheyere's the link for all the AQA Gcse science textbooks end of spread answers. They also have the answers for the small end of page questions.

Quick Reply

Related discussions

  • Kerboodle Answers
  • GCSE Chemistry AQA textbook answers
  • Kerboodle AQA Spanish Higher Book answers
  • AQA GCSE Physics Third Edition book - where to get answers?
  • Kerboodle Physics end of section answers?
  • Kerboodle
  • AQA Triple Science revision guides - is CGP the gold standard?
  • Kerboodle textbook answers
  • HELP! Thinking about joining kerboodle. is it worth it?
  • AQA Exam Style Questions Answers A2
  • show 10 more
  • AQA as Spanish textbook answers
  • AQA French
  • i haven't learnt anything in physics since january and now i'm freaking out
  • GCSE French HELP!!
  • Aqa a level math
  • Kerboodle useful
  • AQA A-Level Biology Notes
  • Best textbook for chemistry
  • How to do well on your GCSE's
  • AQA A Physics A2 Textbook Supplementary Resources

Related articles

Oops, nobody has postedin the last few hours.

Why not re-start the conversation?

  • HMRC Tax Specialist programme 2021
  • So many racists on this website
  • St George's A100 Medicine Reference
  • Escorting Oxford
  • Make it More Hair-ey !!
  • Step up to social work cohort 7 2022
  • My grandparents.
  • UCLAN admissions
  • Is cryptocurrency a good investment?
  • Ask an Imperial College London Student!
  • Detective Constable Met Police Grad Scheme
  • Southampton Oceanography
  • Oxford English Language and Literature Year 2 Reading List
  • Making Friends at uni
  • Oxford Postgraduate Waitlisters 2021
  • Barclays Higher/Graduate Apprenticeships - 2021
  • Border Force EO (South East) April 2021
  • Its Herfest
  • Medicine (A100) waitlist 2021
  • So many racists on this website

Oops, nobody is replying to posts.

Why not reply to an un-answered thread?

  • The Current Year 11 Chat Thread (2020-2021)
  • Physics gcse aqa paper 1 2020
  • The Current Year 10 Chat Thread (2020-2021)
  • Teacher assessed grades
  • tell mee
  • 2021 AQA Exam Materials Leaked.
  • English language paper 1 Tuesday 2 June 2020
  • AQA Chemistry paper 1 higher 2020
  • GCSE 2020 Physics Paper 1 AQA
  • English Language Paper 2 June 2020
  • Head Boy speech. Ideas?
  • Physics paper 1 2019 aqa gcse
  • AQA Biology Paper 1 November 2020!
  • English Paper 1 November 2019 Mark scheme
  • I have LOST my GCSE certificates!! What do I do??
  • Questions asked in prefect interviews
  • Quickest way to resit GCSE (mature adult - no courses)
  • Mock results vs Actual GCSEs
  • Past papers
  • 2020 exam mocks aqa | english language/history | edexcel maths

See more of what you like onThe Student Room

You can personalise what you see on TSR. Tell us a little about yourself to get started.

Have you seen.

Y12's - Have you started planning what you want to do after Y13?

Watched Threads

Spotlight

Oops, nobody has postedin the last few hours.

Why not re-start the conversation?

Oops, nobody is replying to posts.

Why not reply to an un-answered thread?

See more of what you like onThe Student Room

You can personalise what you see on TSR. Tell us a little about yourself to get started.

TSR Support Team

  • RDKGames
  • charco
  • TheConfusedMedic
  • Mr M
  • Lemur14
  • brainzistheword
  • Labrador99
  • absolutelysprout
  • Eimmanuel
  • Sinnoh
  • _gcx
  • barror1
  • Tolgash
  • Hazelly
  • PetitePanda
  • _Mia101
  • jduxie4414
  • Starlight15
  • bamtutor

Get Started

Using TSR

TSR Group

Connect with TSR

© Copyright The Student Room 2017 all rights reserved

The Student Room, Get Revising and Marked by Teachers are trading names of The Student Room Group Ltd.

Register Number: 04666380 (England and Wales), VAT No. 806 8067 22 Registered Office: International House, Queens Road, Brighton, BN1 3XE


Comparative genome analysis of Pseudomonas knackmussii B13, the first bacterium known to degrade chloroaromatic compounds

Pseudomonas knackmussii B13 was the first strain to be isolated in 1974 that could degrade chlorinated aromatic hydrocarbons. This discovery was the prologue for subsequent characterization of numerous bacterial metabolic pathways, for genetic and biochemical studies, and which spurred ideas for pollutant bioremediation. In this study, we determined the complete genome sequence of B13 using next generation sequencing technologies and optical mapping. Genome annotation indicated that B13 has a variety of metabolic pathways for degrading monoaromatic hydrocarbons including chlorobenzoate, aminophenol, anthranilate and hydroxyquinol, but not polyaromatic compounds. Comparative genome analysis revealed that B13 is closest to Pseudomonas denitrificans and Pseudomonas aeruginosa. The B13 genome contains at least eight genomic islands [prophages and integrative conjugative elements (ICEs)], which were absent in closely related pseudomonads. We confirm that two ICEs are identical copies of the 103 kb self-transmissible element ICEclc that carries the genes for chlorocatechol metabolism. Comparison of ICEclc showed that it is composed of a variable and a ‘core’ region, which is very conserved among proteobacterial genomes, suggesting a widely distributed family of so far uncharacterized ICE. Resequencing of two spontaneous B13 mutants revealed a number of single nucleotide substitutions, as well as excision of a large 220 kb region and a prophage that drastically change the host metabolic capacity and survivability.

Fig. S1. Verification of the de novo assembly of the B13 genome by optical mapping. Contigs generated by SOAPdenovo (kmer = 43) or Velvet (kmer = 35) were aligned on the optical map (prepared for KpnI). Three misassembled contigs by Velvet are indicated by black arrowheads. The final B13 genome was verified for the same restriction enzyme with the optical map. Note how the two ICEclc copies are collapsed in the original map (red), but appear in duplicate on the final corrected optical map.

Fig. S2. Cumulative GC-skew plot of the B13 genome. The position +1 corresponds to the predicted origin of replication (oriC), whereas the predicted termination site of replication (ter) is indicated by an arrow. Note how the right replichore is longer than the left because of the presence of two ICEclc copies.

Fig. S3. PCR analysis of instability of USR1 in B13. DNA from B13 cultures in MM with 5 mM of 3-CBA after 7, 14, 21, 28 and 35 generations was used in the PCR. Pictures show amplicons of the 1.6 kb left border of USR1 (between PKB_2522 and PKB_2524) and of the 1.5 kb junction between PKB_2522 and PKB_2737 formed by the loss of USR1. B13-4492 and B13-4493 are two mutants with single parB deletions. N, P. putida KT2440 culture used as negative control M, Mass-ruler DNAladder (Fermentas). Note how all cultures except P. putida amplify both the left border (in high amounts) and the junction (in lower amounts), indicating that a small proportion of cells in culture lost USR1 through recombination.

Fig. S4. Comparisons of flagellar associated genes in USR1 of B13 with orthologous genes in genomes of other Pseudomonads. Maps show relevant genome regions (coordinates displayed) with location of predicted genes as open or coloured pentagons (indicating the direction of the gene). Coloured bars linking genes show the percentage amino acid similarity calculated by Blastp comparison in GenomeMatcher, according to the colour scale. Colours of genes in B13 region USR1 refer to gene functions mentioned in Fig. 5.

Table S1. Assembly statistics of the genomes of Pseudomonas knackmussii B13 and its mutants.

Table S2. In silico prediction of potential prophage regions in the B13 genome by PHAST.

Table S3. Predicted gene functions of ICE similar to ICEclc in five Proteobacterial genomes.

Table S4. Housekeeping genes used in the phylogenetic analysis.

Please note: The publisher is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.


Pharmacologically targeting the myristoylation of the scaffold protein FRS2α inhibits FGF/FGFR-mediated oncogenic signaling and tumor progression

Fibroblast growth factor (FGF)/FGF receptor (FGFR) signaling facilitates tumor initiation and progression. Although currently approved inhibitors of FGFR kinase have shown therapeutic benefit in clinical trials, overexpression or mutations of FGFRs eventually confer drug resistance and thereby abrogate the desired activity of kinase inhibitors in many cancer types. In this study, we report that loss of myristoylation of fibroblast growth factor receptor substrate 2 (FRS2α), a scaffold protein essential for FGFR signaling, inhibits FGF/FGFR-mediated oncogenic signaling and FGF10-induced tumorigenesis. Moreover, a previously synthesized myristoyl-CoA analog, B13, which targets the activity of N-myristoyltransferases, suppressed FRS2α myristoylation and decreased the phosphorylation with mild alteration of FRS2α localization at the cell membrane. B13 inhibited oncogenic signaling induced by WT FGFRs or their drug-resistant mutants (FGFRs DRM ). B13 alone or in combination with an FGFR inhibitor suppressed FGF-induced WT FGFR- or FGFR DRM -initiated phosphoinositide 3-kinase (PI3K) activity or MAPK signaling, inducing cell cycle arrest and thereby inhibiting cell proliferation and migration in several cancer cell types. Finally, B13 significantly inhibited the growth of xenograft tumors without pathological toxicity to the liver, kidney, or lung in vivo In summary, our study suggests a possible therapeutic approach for inhibiting FGF/FGFR-mediated cancer progression and drug-resistant FGF/FGFR mutants.

Keywords: B13 FRS2 cancer drug action fibroblast growth factor (FGF) fibroblast growth factor receptor (FGFR) myristoylation protein acylation.

© 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Conflict of interest statement

The authors declare that they have no conflicts of interest with the contents of this article


Experimental procedures

Growth conditions and genomic DNA isolation

Pseudomonas knackmussii B13 and its derivatives were cultured in type 21C MM (Gerhardt et al., 1981 ) supplemented with either 3-CBA (5 mM), or phenylacetate (5 mM) as sole carbon and energy source. The genomic DNAs of B13, B13-2201 and B13-2811 were isolated from cultures at exponential phase in MM with 3-CBA using the method described previously (Sentchilo et al., 2009 ).

Sequencing

Pseudomonas knackmussii B13 wild-type and mutant DNA sequence libraries with a mean insert size of 0.5 kb were prepared according to the method of Aird et al. ( 2011 ) using Accuprime HF polymerase and betaine in the PCR amplification buffer. Each library was sequenced using 38- and 76-nucleotide PE protocols in a single lane of a flowcell using the Illumina GAII sequencing platform. The raw data were processed using v1.60 of the Illumina data processing pipeline and exported as fastq files. For the B13 wild-type genome, an additional 5 kb insert library was prepared and sequenced on the Pacific Biosciences RS on two SMRT cells according to methods of the manufacturer (Pacific Biosciences).

Genome assembly

Exported 38- and 76-nucleotide PE reads were quality controlled using fastqc (http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/). Non-B13 contaminant reads were filtered out using an in-house Perl script. Where necessary, the reads were trimmed either on the 5′ or on the 3′-end or both to remove low-quality base callings.

Cleaned reads were assembled using either CLCBio (www.clcbio.com), AbySS (Simpson et al., 2009 ), Velvet (Zerbino and Birney, 2008 ) or SOAPdenovo (Li et al., 2010 ), using different kmer-settings (Supporting Information Table S1).

OpGen optical map

An optical map of B13 genomic DNA for the restriction enzyme KpnI was generated by OpGen (Maryland, USA). The map was used in the program MapSolver (OpGen) to correctly position the contigs generated by the four different assembly programs. We chose contigs generated by SOAPdenovo as the best quality assembly and scaffolded the contigs according to the map (Supporting Information Fig. S2).

Genome finishing

A draft B13 wild-type genome was assembled by combining SOAPdenovo scaffolds and PacBio reads, and further verified by multiplex PCR. Primers to be tested in multiplex PCR using B13 genomic DNA were selected from within 400 bp of both contig and scaffold ends by using Consed (Gordon et al., 1998 ), R (http://www.R-project.org) and an in-house script. Positive PCR products were purified and sequenced using standard Sanger technology, and sequences were used to close all gaps. The draft complete genome sequence was then verified by remapping all individual reads and removing final inconsistencies using PrInSeS (Massouras et al., 2010 ). The final gapless B13 genome sequence was submitted to the European Nucleotide Archive and is accessible under accession number HG322950.

Annotation

The P. knackmussii B13 genome sequence was automatically annotated using GenDB (Meyer et al., 2003 ). Functional annotation was derived from BLAST (Altschul et al., 1997 ) sequence similarity searches to Swiss-Prot/UniProtKB (UniProt, 2012 ) as well as RefSeq (Pruitt et al., 2012 ). In case no strong similarity was detected, BLAST results were manually analysed by comparison to the non-redundant NCBI database, to KEGG (Kanehisa et al., 2012 ) or to COG (Tatusov et al., 2000 ), as well as through hidden Markov model searches against the Pfam (Finn et al., 2008 ) and TIGRFAM databases (Haft et al., 2003 ). Manual annotations were focused in particular on potential GI regions, the USR1 region, on flagellar genes and on metabolic pathways for the degradation of aromatic compounds.

Phylogenetic analysis

The nucleotide sequences of 16S rRNA genes from 12 Pseudomonas species plus Escherichia coli MG1655 as an outgroup were retrieved from the NCBI database. The sequences were aligned with the program MUSCLE (https://www.ebi.ac.uk/Tools/msa/muscle/), and a maximum-likelihood (ML) tree was reconstructed using MEGA 5.2.2 with the Tamura-Nei model and the Nearest-Neighbor-Interchange (NNI) move, further applying 1000 bootstrap replicates (Tamura et al., 2011 ). The amino acid sequences of 20 conserved housekeeping genes (Supporting Information Table S4), which are considered not to have been horizontally transferred (Ciccarelli et al., 2006 ), were selected from Microscope Genoscope (http://www.genoscope.cns.fr/agc/microscope/home/). Amino acid sequences were aligned with MUSCLE and concatenated with the help of an in-house script. A phylogenetic tree was reconstructed by using the ML method with Jones-Taylor-Thornton model, NNI move and 100 bootstrap replicates.

Sequence comparison

The B13 genomes were compared in silico to other pseudomonads by using the softwares BRIG (Alikhan et al., 2011 ), ARTEMIS (Rutherford et al., 2000 ) and GenomeMatcher (Ohtsubo et al., 2008 ). Potential ICEclc homologue regions in other bacterial genomes were detected by using MegaBlast (http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome). Individual hits were then retrieved and manually searched for the nearby presence of ICEclc hallmark genes such as the integrase, a gene for tRNA Gly and the genes parB-shi-parA-alpA, which are located nearby the other end of ICEclc (Fig. 4A). Putative ICE regions were isolated in silico from the host genome and pair-wise compared with ICEclc using WebACT (http://www.webact.org/WebACT/home). Regions with nucleotide sequence similarity above 80% were exported and displayed on the local gene map using DNAPlotter (Carver et al., 2009 ). The final display was edited for clarity in Adobe Illustrator CS6. Nucleotide polymorphisms in the B13-2201 and B13-2811 genomes were detected by remapping their Illumina reads onto the B13 reference genome using SAMtools (Li et al., 2009 ), and visually verified by using IGV (Robinson et al., 2011 ). Large INDELs were detected by MAUVE (Darling et al., 2010 ) using contigs of assembled mutant reads.

PCR analysis

In order to analyse instability of the USR1 region in the B13 genome, B13 was cultured in MM with 5 mM of 3-CBA as a sole carbon and energy source for up to 35 generations. After approximately 7, 14, 21, 28 and 35 generations, cells were harvested from the culture, their DNA was released and used as templates in the PCR. The 1.6 kb left border of USR1 (between PKB_2522 and PKB_2524) and the 1.5 kb junction between PKB_2522 and PKB_2737 formed by the loss of USR1 was amplified using two primer sets PKB2522.d (TCTATTCGCCCGCCTACTG) plus PKB2524.u (CCTGGTCAGGCCAATAATGAG), and PKB2522.d plus PKB2737.u (GTTCAAGCGCGCCTGAAATC) respectively.


B vitamins

B vitamins are a class of water-soluble vitamins that play important roles in cell metabolism and synthesis of red blood cells. [1] Though these vitamins share similar names (B1, B2, B3, etc.), they are chemically distinct compounds that often coexist in the same foods. [1] In general, dietary supplements containing all eight are referred to as a vitamin B complex. Individual B vitamin supplements are referred to by the specific number or name of each vitamin, such as B1 for thiamine, B2 for riboflavin, and B3 for niacin, as examples. [1] Some are more commonly recognized by name than by number: niacin, pantothenic acid, biotin and folate.

Each B vitamin is either a cofactor (generally a coenzyme) for key metabolic processes or is a precursor needed to make one.

List of B vitamins
Vitamin Name Description
Vitamin B1 Thiamine A coenzyme in the catabolism of sugars and amino acids.
Vitamin B2 Riboflavin A precursor of coenzymes called FAD and FMN, which are needed for flavoprotein enzyme reactions, including activation of other vitamins
Vitamin B3 Niacin (nicotinic acid) A precursor of coenzymes called NAD and NADP, which are needed in many metabolic processes.
Nicotinamide
Nicotinamide riboside
Vitamin B5 Pantothenic acid A precursor of coenzyme A and therefore needed to metabolize many molecules.
Vitamin B6 Pyridoxine A coenzyme in many enzymatic reactions in metabolism.
Pyridoxal
Pyridoxamine
Vitamin B7 Biotin A coenzyme for carboxylase enzymes, needed for synthesis of fatty acids and in gluconeogenesis.
Vitamin B9 Folate A precursor needed to make, repair, and methylate DNA a cofactor in various reactions especially important in aiding rapid cell division and growth, such as in infancy and pregnancy.
Vitamin B12 Cobalamins Commonly cyanocobalamin or methylcobalamin in vitamin supplements. A coenzyme involved in the metabolism of every cell of the human body, especially affecting DNA synthesis and regulation, but also fatty acid metabolism and amino acid metabolism.

Note: other substances once thought to be vitamins were given numbers in the B-vitamin numbering scheme, but were subsequently discovered to be either not essential for life or manufactured by the body, thus not meeting the two essential qualifiers for a vitamin. See section #Related compounds for numbers 4, 8, 10, 11, and others.

B vitamins are found in highest abundance in meat, eggs, and dairy products. [1] Processed carbohydrates such as sugar and white flour tend to have lower B vitamin than their unprocessed counterparts. For this reason, it is required by law in many countries (including the United States) that the B vitamins thiamine, riboflavin, niacin, and folic acid be added back to white flour after processing. This is referred to as "enriched flour" on food labels. B vitamins are particularly concentrated in meat such as turkey, tuna and liver. [2]

Sources for B vitamins also include legumes (pulses or beans), whole grains, potatoes, bananas, chili peppers, tempeh, nutritional yeast, brewer's yeast, and molasses. Although the yeast used to make beer results in beers being a source of B vitamins, [3] their bioavailability ranges from poor to negative as drinking ethanol inhibits absorption of thiamine (B1), [4] [5] riboflavin (B2), [6] niacin (B3), [7] biotin (B7), [8] and folic acid (B9). [9] [10] In addition, each of the preceding studies further emphasizes that elevated consumption of beer and other alcoholic beverages results in a net deficit of those B vitamins and the health risks associated with such deficiencies. [ citation needed ]

The B12 vitamin is not abundantly available from plant products, [11] making B12 deficiency a legitimate concern for vegans. Manufacturers of plant-based foods will sometimes report B12 content, leading to confusion about what sources yield B12. The confusion arises because the standard US Pharmacopeia (USP) method for measuring the B12 content does not measure the B12 directly. Instead, it measures a bacterial response to the food. Chemical variants of the B12 vitamin found in plant sources are active for bacteria, but cannot be used by the human body. This same phenomenon can cause significant over-reporting of B12 content in other types of foods as well. [12]

A common way to increase vitamin B intake is by using dietary supplements. B vitamins are commonly added to energy drinks, many of which have been marketed with large amounts of B vitamins. [13]

Because they are soluble in water, excess B vitamins are generally readily excreted, although individual absorption, use and metabolism may vary. [13] The elderly and athletes may need to supplement their intake of B12 and other B vitamins due to problems in absorption and increased needs for energy production. [ medical citation needed ] In cases of severe deficiency, B vitamins, especially B12, may also be delivered by injection to reverse deficiencies. [14] [ unreliable medical source? ] Both type 1 and type 2 diabetics may also be advised to supplement thiamine based on high prevalence of low plasma thiamine concentration and increased thiamine clearance associated with diabetes. [15] Also, Vitamin B9 (folic acid) deficiency in early embryo development has been linked to neural tube defects. Thus, women planning to become pregnant are usually encouraged to increase daily dietary folic acid intake and/or take a supplement. [16]


Contents

The existence of homeobox genes was first discovered in Drosophila by isolating the gene responsible for a homeotic transformation where legs grow from the head instead of the expected antennae. Walter Gehring identified a gene called antennapedia that caused this homeotic phenotype. [9] Analysis of antennapedia revealed that this gene contained a 180 base pair sequence that encoded a DNA binding domain, which William McGinnis termed the "homeobox". [10] The existence of additional Drosophila genes containing the antennapedia homeobox sequence was independently reported by Ernst Hafen, Michael Levine, William McGinnis, and Walter Jakob Gehring of the University of Basel in Switzerland and Matthew P. Scott and Amy Weiner of Indiana University in Bloomington in 1984. [11] [12] Isolation of homologous genes by Edward de Robertis and William McGinnis revealed that numerous genes from a variety of species contained the homeobox. [13] [14] Subsequent phylogenetic studies detailing the evolutionary relationship between homeobox-containing genes showed that these genes are present in all bilaterian animals.

The characteristic homeodomain protein fold consists of a 60-amino acid long domain composed of three alpha helixes. The following shows the consensus homeodomain (

Helix 2 and helix 3 form a so-called helix-turn-helix (HTH) structure, where the two alpha helices are connected by a short loop region. The N-terminal two helices of the homeodomain are antiparallel and the longer C-terminal helix is roughly perpendicular to the axes established by the first two. It is this third helix that interacts directly with DNA via a number of hydrogen bonds and hydrophobic interactions, as well as indirect interactions via water molecules, which occur between specific side chains and the exposed bases within the major groove of the DNA. [7]

Homeodomain proteins are found in eukaryotes. [2] Through the HTH motif, they share limited sequence similarity and structural similarity to prokaryotic transcription factors, [16] such as lambda phage proteins that alter the expression of genes in prokaryotes. The HTH motif shows some sequence similarity but a similar structure in a wide range of DNA-binding proteins (e.g., cro and repressor proteins, homeodomain proteins, etc.). One of the principal differences between HTH motifs in these different proteins arises from the stereochemical requirement for glycine in the turn which is needed to avoid steric interference of the beta-carbon with the main chain: for cro and repressor proteins the glycine appears to be mandatory, whereas for many of the homeotic and other DNA-binding proteins the requirement is relaxed.

Sequence specificity Edit

Homeodomains can bind both specifically and nonspecifically to B-DNA with the C-terminal recognition helix aligning in the DNA's major groove and the unstructured peptide "tail" at the N-terminus aligning in the minor groove. The recognition helix and the inter-helix loops are rich in arginine and lysine residues, which form hydrogen bonds to the DNA backbone. Conserved hydrophobic residues in the center of the recognition helix aid in stabilizing the helix packing. Homeodomain proteins show a preference for the DNA sequence 5'-TAAT-3' sequence-independent binding occurs with significantly lower affinity. The specificity of a single homeodomain protein is usually not enough to recognize specific target gene promoters, making cofactor binding an important mechanism for controlling binding sequence specificity and target gene expression. To achieve higher target specificity, homeodomain proteins form complexes with other transcription factors to recognize the promoter region of a specific target gene.

Homeodomain proteins function as transcription factors due to the DNA binding properties of the conserved HTH motif. Homeodomain proteins are considered to be master control genes, meaning that a single protein can regulate expression of many target genes. Homeodomain proteins direct the formation of the body axes and body structures during early embryonic development. [17] Many homeodomain proteins induce cellular differentiation by initiating the cascades of coregulated genes required to produce individual tissues and organs. Other proteins in the family, such as NANOG are involved in maintaining pluripotency and preventing cell differentiation.

Hox genes and their associated microRNAs are highly conserved developmental master regulators with tight tissue-specific, spatiotemporal control. These genes are known to be dysregulated in several cancers and are often controlled by DNA methylation. [18] [19] The regulation of Hox genes is highly complex and involves reciprocal interactions, mostly inhibitory. Drosophila is known to use the polycomb and trithorax complexes to maintain the expression of Hox genes after the down-regulation of the pair-rule and gap genes that occurs during larval development. Polycomb-group proteins can silence the HOX genes by modulation of chromatin structure. [20]

Mutations to homeobox genes can produce easily visible phenotypic changes in body segment identity, such as the Antennapedia and Bithorax mutant phenotypes in Drosophila. Duplication of homeobox genes can produce new body segments, and such duplications are likely to have been important in the evolution of segmented animals.

The homeobox itself may have evolved from a non-DNA-binding transmembrane domain at the C-terminus of the MraY enzyme. This is based on metagenomic data acquired from the transitional archaeon, Lokiarchaeum, that is regarded as the prokaryote closest to the ancestor of all eukaryotes. [21] [ unreliable source? ]

Phylogenetic analysis of homeobox gene sequences and homeodomain protein structures suggests that the last common ancestor of plants, fungi, and animals had at least two homeobox genes. [22] Molecular evidence shows that some limited number of Hox genes have existed in the Cnidaria since before the earliest true Bilatera, making these genes pre-Paleozoic. [23] It is accepted that the three major animal ANTP-class clusters, Hox, ParaHox, and NK (MetaHox), are the result of segmental duplications. A first duplication created MetaHox and ProtoHox, the latter of which later duplicated into Hox and ParaHox. The clusters themselves were created by tandem duplications of a single ANTP-class homeobox gene. [24] Gene duplication followed by neofunctionalization is responsible for the many homeobox genes found in eukaryotes. [25] [26] Comparison of homeobox genes and gene clusters has been used to understand the evolution of genome structure and body morphology throughout metazoans. [27]

Hox genes Edit

Hox genes are the most commonly known subset of homeobox genes. They are essential metazoan genes that determine the identity of embryonic regions along the anterior-posterior axis. [28] The first vertebrate Hox gene was isolated in Xenopus by Edward De Robertis and colleagues in 1984. [29] The main interest in this set of genes stems from their unique behavior and arrangement in the genome. Hox genes are typically found in an organized cluster. The linear order of Hox genes within a cluster is directly correlated to the order they are expressed in both time and space during development. This phenomenon is called colinearity.

Mutations in these homeotic genes cause displacement of body segments during embryonic development. This is called ectopia. For example, when one gene is lost the segment develops into a more anterior one, while a mutation that leads to a gain of function causes a segment to develop into a more posterior one. Famous examples are Antennapedia and bithorax in Drosophila, which can cause the development of legs instead of antennae and the development of a duplicated thorax, respectively. [30]

In vertebrates, the four paralog clusters are partially redundant in function, but have also acquired several derived functions. For example, HoxA and HoxD specify segment identity along the limb axis. [31] [32] Specific members of the Hox family have been implicated in vascular remodeling, angiogenesis, and disease by orchestrating changes in matrix degradation, integrins, and components of the ECM. [33] HoxA5 is implicated in atherosclerosis. [34] [35] HoxD3 and HoxB3 are proinvasive, angiogenic genes that upregulate b3 and a5 integrins and Efna1 in ECs, respectively. [36] [37] [38] [39] HoxA3 induces endothelial cell (EC) migration by upregulating MMP14 and uPAR. Conversely, HoxD10 and HoxA5 have the opposite effect of suppressing EC migration and angiogenesis, and stabilizing adherens junctions by upregulating TIMP1/downregulating uPAR and MMP14, and by upregulating Tsp2/downregulating VEGFR2, Efna1, Hif1alpha and COX-2, respectively. [40] [41] HoxA5 also upregulates the tumor suppressor p53 and Akt1 by downregulation of PTEN. [42] Suppression of HoxA5 has been shown to attenuate hemangioma growth. [43] HoxA5 has far-reaching effects on gene expression, causing

300 genes to become upregulated upon its induction in breast cancer cell lines. [43] HoxA5 protein transduction domain overexpression prevents inflammation shown by inhibition of TNFalpha-inducible monocyte binding to HUVECs. [44] [45]

LIM genes Edit

LIM genes (named after the initial letters of the names of three proteins where the characteristic domain was first identified) encode two 60 amino acid cysteine and histidine-rich LIM domains and a homeodomain. The LIM domains function in protein-protein interactions and can bind zinc molecules. LIM domain proteins are found in both the cytosol and the nucleus. They function in cytoskeletal remodeling, at focal adhesion sites, as scaffolds for protein complexes, and as transcription factors. [46]

Pax genes Edit

Most Pax genes contain a homeobox and a paired domain that also binds DNA to increase binding specificity, though some Pax genes have lost all or part of the homeobox sequence. [47] Pax genes function in embryo segmentation, nervous system development, generation of the frontal eye fields, skeletal development, and formation of face structures. Pax 6 is a master regulator of eye development, such that the gene is necessary for development of the optic vesicle and subsequent eye structures. [48]

POU genes Edit

Proteins containing a POU region consist of a homeodomain and a separate, structurally homologous POU domain that contains two helix-turn-helix motifs and also binds DNA. The two domains are linked by a flexible loop that is long enough to stretch around the DNA helix, allowing the two domains to bind on opposite sides of the target DNA, collectively covering an eight-base segment with consensus sequence 5'-ATGCAAAT-3'. The individual domains of POU proteins bind DNA only weakly, but have strong sequence-specific affinity when linked. The POU domain itself has significant structural similarity with repressors expressed in bacteriophages, particularly lambda phage.

As in animals, the plant homeobox genes code for the typical 60 amino acid long DNA-binding homeodomain or in case of the TALE (three amino acid loop extension) homeobox genes for an atypical homeodomain consisting of 63 amino acids. According to their conserved intron–exon structure and to unique codomain architectures they have been grouped into 14 distinct classes: HD-ZIP I to IV, BEL, KNOX, PLINC, WOX, PHD, DDT, NDX, LD, SAWADEE and PINTOX. [25] Conservation of codomains suggests a common eukaryotic ancestry for TALE [49] and non-TALE homeodomain proteins. [50]

The Hox genes in humans are organized in four chromosomal clusters:

name chromosome gene
HOXA (or sometimes HOX1) - [email protected] chromosome 7 HOXA1, HOXA2, HOXA3, HOXA4, HOXA5, HOXA6, HOXA7, HOXA9, HOXA10, HOXA11, HOXA13
HOXB - [email protected] chromosome 17 HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13
HOXC - [email protected] chromosome 12 HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXC10, HOXC11, HOXC12, HOXC13
HOXD - [email protected] chromosome 2 HOXD1, HOXD3, HOXD4, HOXD8, HOXD9, HOXD10, HOXD11, HOXD12, HOXD13

ParaHox genes are analogously found in four areas. They include CDX1, CDX2, CDX4 GSX1, GSX2 and PDX1. Other genes considered Hox-like include EVX1, EVX2 GBX1, GBX2 MEOX1, MEOX2 and MNX1. The NK-like (NKL) genes, some of which are considered "MetaHox", are grouped with Hox-like genes into a large ANTP-like group. [51] [52]

Humans have a "distal-less homeobox" family: DLX1, DLX2, DLX3, DLX4, DLX5, and DLX6. Dlx genes are involved in the development of the nervous system and of limbs. [53] They are considered a subset of the NK-like genes. [51]

Human TALE (Three Amino acid Loop Extension) homeobox genes for an "atypical" homeodomain consist of 63 rather than 60 amino acids: IRX1, IRX2, IRX3, IRX4, IRX5, IRX6 MEIS1, MEIS2, MEIS3 MKX PBX1, PBX2, PBX3, PBX4 PKNOX1, PKNOX2 TGIF1, TGIF2, TGIF2LX, TGIF2LY. [51]

In addition, humans have the following homeobox genes and proteins: [51]


Pharmacologically targeting the myristoylation of the scaffold protein FRS2α inhibits FGF/FGFR-mediated oncogenic signaling and tumor progression

Fibroblast growth factor (FGF)/FGF receptor (FGFR) signaling facilitates tumor initiation and progression. Although currently approved inhibitors of FGFR kinase have shown therapeutic benefit in clinical trials, overexpression or mutations of FGFRs eventually confer drug resistance and thereby abrogate the desired activity of kinase inhibitors in many cancer types. In this study, we report that loss of myristoylation of fibroblast growth factor receptor substrate 2 (FRS2α), a scaffold protein essential for FGFR signaling, inhibits FGF/FGFR-mediated oncogenic signaling and FGF10-induced tumorigenesis. Moreover, a previously synthesized myristoyl-CoA analog, B13, which targets the activity of N-myristoyltransferases, suppressed FRS2α myristoylation and decreased the phosphorylation with mild alteration of FRS2α localization at the cell membrane. B13 inhibited oncogenic signaling induced by WT FGFRs or their drug-resistant mutants (FGFRs DRM ). B13 alone or in combination with an FGFR inhibitor suppressed FGF-induced WT FGFR- or FGFR DRM -initiated phosphoinositide 3-kinase (PI3K) activity or MAPK signaling, inducing cell cycle arrest and thereby inhibiting cell proliferation and migration in several cancer cell types. Finally, B13 significantly inhibited the growth of xenograft tumors without pathological toxicity to the liver, kidney, or lung in vivo In summary, our study suggests a possible therapeutic approach for inhibiting FGF/FGFR-mediated cancer progression and drug-resistant FGF/FGFR mutants.

Keywords: B13 FRS2 cancer drug action fibroblast growth factor (FGF) fibroblast growth factor receptor (FGFR) myristoylation protein acylation.

© 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Conflict of interest statement

The authors declare that they have no conflicts of interest with the contents of this article


B13. Summary - Biology

Search for the best summaries

Have you written loads of study guides or do you write a lot of notes? On Stuvia, you can sell your study work in a jiffy. Upload your document(s), determine your own price and earn money each time you sell your document(s). Just think about it, you can finally kiss that dreary part-time job goodbye!

  • 5
  • 4
  • 3
  • 2
  • 1
  • All languages
  • Dutch
  • English
  • Deutsch
  • Français
  • Español
  • Tot
  • Minimum
  • Maximum

All 2.393 results

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Preview 4 out of 40 pages

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Preview 4 out of 35 pages

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Preview 4 out of 50 pages

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Preview 4 out of 46 pages

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Preview 3 out of 21 pages

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Sell your knowledge on Stuvia

Hundred thousands of people are searching for your content every day. You can easily upload your summaries to our platform and start earning money from your study notes.

Sign up for free today and start earning while helping others!

BIOLOGY 9700&sol01Paper 1 Multiple Choice For examination from 2022SPECIMEN PAPER

Preview 3 out of 18 pages

BIOLOGY 9700&sol01Paper 1 Multiple Choice For examination from 2022SPECIMEN PAPER

Official A-level Biology OCR 2020 paper 3&period Good for revision for mini exams&excl

  • Bundle
  • Exam (elaborations)
  • &bull 29 pages &bull
  • by AlexHackney &bull
  • uploaded 08-05-2021

Preview 3 out of 29 pages

Official A-level Biology OCR 2020 paper 3&period Good for revision for mini exams&excl

2020 AQA AS Biology Paper 1 MARKSCHEME ONLY

Preview 3 out of 28 pages

2020 AQA AS Biology Paper 1 MARKSCHEME ONLY

AQA A level biology notes from an A&ast student &lparI obtained an A&ast in A level biology&period&rpar&NewLine&NewLineNotes covering&colon Synaptic transmission&comma resting potential&comma the pacinian corpuscle&comma saltatory conduction and action potentials&period

  • Book
  • Class notes
  • &bull 2 pages &bull
  • by maiziehall &bull
  • uploaded 12-10-2020

AQA A level biology notes from an A&ast student &lparI obtained an A&ast in A level biology&period&rpar&NewLine&NewLineNotes covering&colon Synaptic transmission&comma resting potential&comma the pacinian corpuscle&comma saltatory conduction and action potentials&period

Full biological notes including&colon &NewLineNervous system &NewLineNeurotransmitters &NewLineRecreational drugs and the rewards system &NewLineThe brain&comma limbic system and aggression &NewLineRaine et al&period &NewLineEvolutionary approach &NewLineBiological approach &NewLineBrendagn et al&period &NewLinePsychodynamic theory &NewLineCorrelational studies &NewLineBrain scanning techniques &NewLinePractical &NewLineKey question &NewLineIssues and debates

  • Book & Bundle
  • Class notes
  • &bull 39 pages &bull
  • by saisha1602 &bull
  • uploaded 25-05-2021

Preview 4 out of 39 pages

Full biological notes including&colon &NewLineNervous system &NewLineNeurotransmitters &NewLineRecreational drugs and the rewards system &NewLineThe brain&comma limbic system and aggression &NewLineRaine et al&period &NewLineEvolutionary approach &NewLineBiological approach &NewLineBrendagn et al&period &NewLinePsychodynamic theory &NewLineCorrelational studies &NewLineBrain scanning techniques &NewLinePractical &NewLineKey question &NewLineIssues and debates


Watch the video: B13 - AQA GCSE 1-9 REPRODUCTION WHOLE TOPIC (December 2021).